ID: 1040065483

View in Genome Browser
Species Human (GRCh38)
Location 8:43140925-43140947
Sequence GGTCCCGGCGTCCCGATCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040065483_1040065497 20 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065497 8:43140968-43140990 GGCGGGCCAGCCGAGGATCGGGG No data
1040065483_1040065496 19 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065496 8:43140967-43140989 AGGCGGGCCAGCCGAGGATCGGG No data
1040065483_1040065492 3 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065492 8:43140951-43140973 CAAACTGGCAGCCAGGAGGCGGG No data
1040065483_1040065502 28 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065502 8:43140976-43140998 AGCCGAGGATCGGGGGGGCTCGG No data
1040065483_1040065489 -1 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065489 8:43140947-43140969 CCCACAAACTGGCAGCCAGGAGG No data
1040065483_1040065491 2 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065491 8:43140950-43140972 ACAAACTGGCAGCCAGGAGGCGG No data
1040065483_1040065486 -4 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065486 8:43140944-43140966 GACCCCACAAACTGGCAGCCAGG No data
1040065483_1040065493 13 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065493 8:43140961-43140983 GCCAGGAGGCGGGCCAGCCGAGG No data
1040065483_1040065499 22 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065499 8:43140970-43140992 CGGGCCAGCCGAGGATCGGGGGG No data
1040065483_1040065500 23 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065500 8:43140971-43140993 GGGCCAGCCGAGGATCGGGGGGG No data
1040065483_1040065498 21 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065498 8:43140969-43140991 GCGGGCCAGCCGAGGATCGGGGG No data
1040065483_1040065495 18 Left 1040065483 8:43140925-43140947 CCGCGGATCGGGACGCCGGGACC No data
Right 1040065495 8:43140966-43140988 GAGGCGGGCCAGCCGAGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040065483 Original CRISPR GGTCCCGGCGTCCCGATCCG CGG (reversed) Intronic