ID: 1040067028

View in Genome Browser
Species Human (GRCh38)
Location 8:43154348-43154370
Sequence CCAGGACCTGCTGTGCGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4873
Summary {0: 1, 1: 3, 2: 52, 3: 1134, 4: 3683}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040067028 Original CRISPR CCAGGACCTGCTGTGCGGTG GGG (reversed) Intronic
Too many off-targets to display for this crispr