ID: 1040068493

View in Genome Browser
Species Human (GRCh38)
Location 8:43169328-43169350
Sequence TTTTATGTTTATATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1093
Summary {0: 1, 1: 1, 2: 2, 3: 72, 4: 1017}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040068493 Original CRISPR TTTTATGTTTATATTGAGGA AGG Intronic
900328134 1:2120982-2121004 TTTTATGTTTTTATTAGAGACGG + Intronic
901212079 1:7532469-7532491 TTTTATGTTTGTTTTAGGGACGG + Intronic
901522338 1:9794787-9794809 TGTTATGTTTTGATTAAGGATGG - Intronic
901586004 1:10293191-10293213 TTATATGTTTATATTATGAAAGG + Intronic
902148042 1:14420238-14420260 TTTTATGTCTAGCTAGAGGATGG - Intergenic
902429831 1:16354309-16354331 TTTTATGTATTTATTGAGACAGG + Intronic
902430094 1:16356169-16356191 TTTTTTTTTTTTTTTGAGGAAGG + Intronic
902852939 1:19175796-19175818 TTTTATGTTTTTTTTGAGACAGG + Intronic
903037875 1:20506203-20506225 TTTGATGTTTATATGAAAGATGG - Intronic
903456295 1:23489281-23489303 TTTAATTTTTATATGGAGGTCGG + Intergenic
903839798 1:26230641-26230663 TTTTTTTTTTATACTGAGGTGGG + Intergenic
903872846 1:26449404-26449426 TTTTATTTTTATTTTGAGACAGG + Intronic
904204171 1:28842033-28842055 TTTTATTTTTATTTTGAGACAGG + Intronic
904230515 1:29066843-29066865 TTTTATATTTTTATTAAAGATGG + Intronic
904637159 1:31890965-31890987 TTTTTTTTTTTTTTTGAGGAGGG - Intergenic
904667803 1:32137180-32137202 TTTTTTGTTTGTTTTGAGAAAGG + Intronic
904967494 1:34388182-34388204 TTTTGTGTCTATATTCATGAGGG + Intergenic
905176896 1:36142106-36142128 GTTTTTGTTTTTATTGAGGAGGG - Intronic
905815911 1:40950687-40950709 TCTTATCTGTATATTGAGTATGG + Intergenic
905877467 1:41442022-41442044 TTTTATTTTTTTTTTGAGGCAGG - Intergenic
905965481 1:42091140-42091162 TTTTATGTTTTTATTCAGTATGG - Intergenic
906235776 1:44208119-44208141 TTTTATTTTTATTTAGAGCAGGG - Intergenic
906722155 1:48016254-48016276 TTATATGTTTATATTGATTTTGG + Intergenic
906784738 1:48604903-48604925 TTTTATGTAGATATGGATGAAGG - Intronic
906871837 1:49491418-49491440 TTTTTTCTTTCTTTTGAGGAGGG - Intronic
908008019 1:59746665-59746687 TTTTATGTTTTTGTTGAGATAGG + Intronic
908356582 1:63329268-63329290 TTTTATGTTAAAATGGGGGAGGG - Intergenic
908590030 1:65621219-65621241 TTTTATTTTTATATTTTTGAAGG + Intronic
909104196 1:71388822-71388844 TTTTATGTTTTTATTATGAAGGG - Intergenic
909146195 1:71935967-71935989 TTTTGTATTTATATTGGAGAGGG + Intronic
909738253 1:78994566-78994588 TTTTATTTTTAAACTGACGATGG - Intronic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
909892663 1:81027570-81027592 TTTTATTTTTAAATTCAGGAGGG - Intergenic
909993307 1:82249800-82249822 TTATTTGTTTATTTTGAGGTAGG - Intergenic
910271614 1:85401504-85401526 TTTTTTTTTTTTTTTGAGGAGGG + Intronic
910797997 1:91117839-91117861 TTTTATGTTAAGTTTGATGAAGG - Intergenic
911145694 1:94550412-94550434 TTTTATTTTTATAATGAAGAGGG + Intergenic
911214060 1:95173033-95173055 TATTATGTTTAAATTTAGAAAGG + Intronic
911282760 1:95951854-95951876 CTTTATGTTTCTGTTGAGCAGGG + Intergenic
911303414 1:96204105-96204127 TTTCATGTTTGAATTGTGGAAGG + Intergenic
911736292 1:101339986-101340008 TTTTTTTTTTATATTGACTAAGG - Intergenic
911862014 1:102963470-102963492 TTTCATGTATAAATAGAGGATGG + Intronic
912022538 1:105123150-105123172 TATTATCTTTATATGGTGGAAGG + Intergenic
912267777 1:108175682-108175704 TTTTATTTTTTTTTTGAGAAAGG - Intronic
913536630 1:119779109-119779131 TTTTGTCTTTATATTGAGAAGGG - Intergenic
913654224 1:120945895-120945917 TTTTATATTTTTATTAAAGACGG - Intergenic
913697361 1:121340238-121340260 TTTGATGTTCATTTTGAGGGTGG + Intronic
914140197 1:144939815-144939837 TTTGATGTTCATTTTGAGGGTGG - Intronic
914265538 1:146035371-146035393 TTTTTTTTTTTTTTTGAGGAAGG + Intergenic
914504431 1:148276401-148276423 TCTTTTGTTTATAATGAGCATGG + Intergenic
914519909 1:148405990-148406012 TTTTATATTTTTATTAAAGACGG - Intergenic
914644422 1:149640058-149640080 TTTTATATTTTTATTAAAGACGG - Intergenic
915234131 1:154468076-154468098 TTTTGTTTTTGTATTGAAGAGGG + Exonic
915391206 1:155545848-155545870 TTTTATGTTTTTAATGGAGATGG - Intronic
915623106 1:157098264-157098286 TTTTATATTTTTATTGGAGATGG + Intronic
916391438 1:164335124-164335146 TTTTCTGTTTATTTCGAAGAAGG - Intergenic
916666584 1:166973251-166973273 TTTTATTTTTGTTTTGAGGGAGG - Intronic
916865077 1:168847995-168848017 TTTAATGTTTATATCGAACATGG - Intergenic
916902329 1:169241905-169241927 TTTTATATTTATATTTATAAGGG - Intronic
916962255 1:169900883-169900905 TTTAATGTTTTTATTAATGAGGG - Intergenic
917064509 1:171076928-171076950 TGTTCTATTTATATTGGGGATGG + Intergenic
917150745 1:171942047-171942069 TCATATGTTTGAATTGAGGATGG + Intronic
917576324 1:176325041-176325063 TTTTATATTTTTATTGGAGATGG + Intergenic
917734996 1:177912189-177912211 TTTTGTGTTTTTAGTAAGGATGG - Intergenic
917863994 1:179175850-179175872 TTTTTTTTTTTTTTTGAGGAGGG + Intronic
918012982 1:180604856-180604878 TTTTATCTTTATTTTGAGACAGG - Intergenic
918569963 1:185978677-185978699 TTTTATTTTTATATTTTGGGTGG + Intronic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
918789569 1:188808953-188808975 TTTGCTCTTTGTATTGAGGATGG - Intergenic
918976980 1:191502294-191502316 TTTTGAGTGTATATTTAGGAAGG - Intergenic
919229175 1:194750962-194750984 TTTTATATTTATTTTGAGACAGG - Intergenic
919229344 1:194753650-194753672 TTCTATCCTTATATTTAGGAAGG + Intergenic
919341267 1:196310469-196310491 TTTAATGTTTAGATTGGTGATGG - Intronic
919463556 1:197906576-197906598 TTTTTTGCTTATAATAAGGAAGG - Intronic
919583072 1:199401164-199401186 TTTTATCTTTATATTGTGTATGG - Intergenic
919734760 1:200939781-200939803 TTTTGTGTTTTTAGTGAAGATGG + Intergenic
920168254 1:204051732-204051754 TTTTGTGTGTATTATGAGGAAGG + Intergenic
920484695 1:206358570-206358592 TTTGATGTTCATTTTGAGGGTGG + Intronic
920524380 1:206655932-206655954 ATTTATTTTTATTTTGAAGATGG + Intronic
920882134 1:209889810-209889832 TTTAATTTTTATAGTGAGCAGGG + Intergenic
920913864 1:210242206-210242228 TTTTATGATTATTTTGAGACCGG + Exonic
920918917 1:210281732-210281754 TTTTTAGTTTCTAGTGAGGAAGG + Intergenic
921465870 1:215486918-215486940 TTTCATGTTTAAATAGAGGGAGG - Intergenic
921557027 1:216611204-216611226 TTTTTTTTTTTTTTTGAGGACGG - Intronic
921622412 1:217340472-217340494 TTTTATTTTTATAGAGATGAGGG + Intergenic
921739243 1:218665170-218665192 TTTTGTGTTTATCATGAAGATGG + Intergenic
922201603 1:223406906-223406928 TTTTATGTTTATATTCATGAAGG - Intergenic
922607478 1:226899264-226899286 TTTTATGATTGTATTTAGTAGGG + Exonic
922944430 1:229499595-229499617 TTTTATTTTTAAATAGAGGTGGG - Intronic
922995023 1:229949833-229949855 TTGTATGTGTAACTTGAGGAAGG - Intergenic
1062824781 10:559411-559433 TTTGTTGTTTTTGTTGAGGAAGG + Intronic
1062981863 10:1730721-1730743 TTCCATATTTATATTAAGGAGGG - Intronic
1063303191 10:4872308-4872330 TTTTAAGGTGATAATGAGGAAGG + Intergenic
1063912999 10:10851453-10851475 TTTAAGTTTTATATTGAGGTCGG - Intergenic
1063968435 10:11364568-11364590 TTTTATGTTTATTTTTGAGAGGG + Intergenic
1064567814 10:16660650-16660672 TTTTTTTTTTTTTTTGAGGAAGG + Intronic
1064682843 10:17828644-17828666 TCTTATGTTTAAATTAAGAAGGG + Intronic
1064860618 10:19821076-19821098 TTTTATTTTTATTTTGAGGCAGG - Intronic
1065056794 10:21852850-21852872 TAATATGCTTATATTGTGGAGGG + Intronic
1065255733 10:23866066-23866088 TTTGATGTTTGTATGGAAGAAGG - Intronic
1065568787 10:27046314-27046336 CTTTATTTTTCTATGGAGGAAGG - Intronic
1065619669 10:27568216-27568238 ATGTGTGTTTATATTGATGAGGG + Intergenic
1065677457 10:28193382-28193404 TTTTATGTTTTTAGTGGAGACGG + Intronic
1066041468 10:31552138-31552160 TTGTATGTTTAGATAGAGAATGG - Intergenic
1066095842 10:32071280-32071302 TTTTTTGTTTTTTTTTAGGACGG + Intergenic
1066513774 10:36132313-36132335 TTTTATGTCTATTTTGAGACAGG - Intergenic
1066555831 10:36612193-36612215 TTTTAGGTATATCTTGAGTAGGG + Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067386201 10:45819499-45819521 TTTGATGTGTATGTTGATGATGG - Intergenic
1067448072 10:46365063-46365085 TTTGATGTGTGTATTGATGATGG + Intergenic
1067589308 10:47495698-47495720 TTTGATGTGTGTATTGATGATGG - Intergenic
1067636432 10:48003777-48003799 TTTGATGTGTGTATTGATGATGG - Intergenic
1068172775 10:53417578-53417600 TTCTATGTTGATTTTGATGAGGG + Intergenic
1068352029 10:55860781-55860803 TTTTATATTTTTATGGGGGAGGG - Intergenic
1069471138 10:68690576-68690598 TTTTATGTTTTTTTTGGAGACGG - Intronic
1071042088 10:81322730-81322752 TTAGATGTCTATATTAAGGAAGG + Intergenic
1071246255 10:83767993-83768015 TTTTGTGTTTATATTCTTGAGGG + Intergenic
1071350868 10:84743219-84743241 TTTTATTTTTTTATTGAGATGGG + Intergenic
1071832124 10:89382154-89382176 TATTATGGTTATATTGAGTCAGG + Intronic
1071901135 10:90120946-90120968 TTTTATTTTTATTTTGGGGGAGG - Intergenic
1072512180 10:96138945-96138967 TTTTTTTTTTTTTTTGAGGAAGG + Intronic
1072630453 10:97141968-97141990 TTTTTTGTTTTTATAGAGTAAGG + Intronic
1072845528 10:98826267-98826289 TTTTATGTCTGTATTGTGTAGGG + Intronic
1072968214 10:99993030-99993052 TTTTATTTTTATGTTGAGTCAGG - Intronic
1072982599 10:100111933-100111955 TGCTATGTTTATCTTGAGTAAGG - Intergenic
1073273779 10:102290101-102290123 TTTTGTGTTTTTGTTGAGAAAGG - Intronic
1073437041 10:103524104-103524126 TTTTTTGTTTATTTTGATAATGG + Intronic
1073586798 10:104718139-104718161 TTATTTATTTATTTTGAGGACGG - Intronic
1073705407 10:105978010-105978032 TTTTATTTTTATTTTAAAGAAGG - Intergenic
1073837220 10:107458276-107458298 TGTTATGTTTATATACAGTATGG - Intergenic
1074077422 10:110141827-110141849 CTTTAAGTTAATATTGAGCAAGG + Intergenic
1077212527 11:1378520-1378542 TTTTGTGTGTATATTCAGAAAGG - Intergenic
1077397895 11:2334468-2334490 TTTTGTGTTTTTATTGAGATGGG + Intergenic
1078019516 11:7644252-7644274 TTTTATGTTTATATAGAATTAGG + Intronic
1078130214 11:8608152-8608174 TTTTATGTTTTCATTGAGACAGG + Intergenic
1078167806 11:8904149-8904171 TTTTCTGTGTATATTCATGAGGG - Intronic
1078600275 11:12724473-12724495 CTTTATGTTTGTAATGAAGAGGG + Intronic
1078636982 11:13060809-13060831 TATTATCTTTATTTTGATGATGG + Intergenic
1078913287 11:15753644-15753666 TTTTATATTTCTTGTGAGGAAGG + Intergenic
1079418485 11:20263266-20263288 TTTTATCTTTATTTTGAGACAGG - Intergenic
1079496126 11:21046706-21046728 TTATTTATTTATATTGAGGCAGG + Intronic
1079824207 11:25170297-25170319 TTTTATGTTTCTGTTGATCAGGG + Intergenic
1079978162 11:27118917-27118939 TTTTTTTTTTTTTTTGAGGAAGG - Intronic
1080074442 11:28132568-28132590 TTTTAAGTTTGTCTTGCGGAGGG + Intronic
1080342102 11:31276434-31276456 TATTATGATTATTTTGAGAAAGG + Intronic
1080347265 11:31338895-31338917 TGTAAAGTTTACATTGAGGACGG - Intronic
1080536994 11:33231305-33231327 TTTTTTATTTATTTTGAGGCAGG - Intergenic
1080812144 11:35715464-35715486 ATTTATGACTATATGGAGGAGGG + Intronic
1080988584 11:37502794-37502816 TTTTTTTTTTTTTTTGAGGAAGG + Intergenic
1081260331 11:40952133-40952155 TATTATTTTTATTTTAAGGATGG + Intronic
1081512342 11:43788678-43788700 TTTTTTTTTTTTTTTGAGGAAGG - Intronic
1082861093 11:57857376-57857398 ATTTATGTTTTTATTGAGACGGG - Intergenic
1083602803 11:63959381-63959403 TTTTATGTTTTTAGTAAAGACGG - Intergenic
1083715591 11:64574000-64574022 TTTTATGTTTATATCCATAAGGG - Intergenic
1083948054 11:65936697-65936719 TTTTATGTTTTTCTTGAGACAGG + Intergenic
1083977107 11:66131947-66131969 TTTTTTTTTTTTAATGAGGAAGG - Intronic
1084154583 11:67306623-67306645 TTTTTTGTTTCTGCTGAGGAAGG - Intronic
1084856266 11:71989249-71989271 TTTTATATTTTTAGTAAGGATGG + Intronic
1085969672 11:81572605-81572627 TTTTCTATTTATATGCAGGATGG - Intergenic
1086306973 11:85490993-85491015 TTTTATGTATATATTCATCAGGG - Intronic
1086572988 11:88306441-88306463 TTTTGGGTTTATATGGGGGAAGG - Intronic
1086776170 11:90835489-90835511 TGTTATGTATATATAGAGAAAGG + Intergenic
1086834633 11:91605270-91605292 TTTCATGTTTTTAGTGAAGATGG - Intergenic
1087313155 11:96574448-96574470 TTTTACATTTATATTAATGAGGG + Intergenic
1088043611 11:105420003-105420025 TTATCTGTTTATATTGCGGCTGG - Intergenic
1088135944 11:106555246-106555268 TTTTAACTTTATATTGCTGAGGG - Intergenic
1088159529 11:106853357-106853379 TTTTTTGTTTTTATTGGGGCTGG + Intronic
1088267418 11:108001062-108001084 TTTTATTTTTATTTTGAGACAGG + Intergenic
1089822765 11:121243451-121243473 TATTATGTTTATATTTATTAAGG + Intergenic
1089871606 11:121678254-121678276 TTTTGTGTTTATATTTATGAAGG + Intergenic
1090127768 11:124106177-124106199 TTTTGTGTCTATATTCATGAAGG - Intergenic
1090292151 11:125554843-125554865 TTTTGTGTTTTTATTGGAGACGG - Intergenic
1090527659 11:127554831-127554853 TTTGATGTTTATGTTTAGTAAGG + Intergenic
1090599038 11:128350614-128350636 TTTTCTGATGATACTGAGGATGG - Intergenic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1091551204 12:1536194-1536216 TTTTGTGGTGATATTGATGAAGG + Intronic
1092512907 12:9176495-9176517 TTTTATTTTTATTTTGAATATGG - Intronic
1092880807 12:12886448-12886470 TTTAATTTTTGTAGTGAGGAGGG + Intergenic
1093012289 12:14120969-14120991 TTTTATGTCTATATTCATGAGGG - Intergenic
1093066622 12:14665039-14665061 TTTTATGTTTTTAGTGGAGACGG - Intronic
1093553146 12:20438963-20438985 TTTTGTGTTTTTAGTGAAGACGG + Intronic
1093818899 12:23586778-23586800 TTTGATGAATATGTTGAGGAGGG - Intronic
1093995632 12:25639135-25639157 TTTTGTGTGTAATTTGAGGAAGG - Intronic
1094191025 12:27698721-27698743 TTTTATGTATTTATTGAGATGGG - Intergenic
1094336815 12:29366998-29367020 TAATTTGTTTATATTGGGGATGG - Intronic
1094749599 12:33390561-33390583 TTTTATATATATATAGAGGGTGG - Intronic
1095111883 12:38303936-38303958 TTTTATGTTTATACCCAGGCTGG - Intergenic
1095159664 12:38902073-38902095 TTTTATCTTCATTTTGGGGAAGG - Intronic
1095995725 12:48082183-48082205 TTTAAAGTTTGTATTGAGGCCGG - Intronic
1096031659 12:48421532-48421554 TTTTTTTTTTAGATGGAGGATGG + Intergenic
1096341224 12:50801539-50801561 TTTTGTGTCTATATTCATGAAGG - Intronic
1096645205 12:53029885-53029907 TATTATTATTATTTTGAGGAAGG - Intronic
1097284490 12:57866997-57867019 TTTTATTTTTAAATTGAGATAGG + Intergenic
1097504637 12:60450349-60450371 TTTTATGTTGATATTTGGCATGG - Intergenic
1097836798 12:64281396-64281418 TTTTATGTTTTTAGTTAAGACGG - Intronic
1097854108 12:64443458-64443480 TTTTATTTTTATTTTGAGACAGG + Intronic
1098111202 12:67123523-67123545 ATTTGTGTGTTTATTGAGGAGGG - Intergenic
1098278146 12:68834269-68834291 TTTTATGTTTTTAGTGGAGACGG - Intronic
1098344488 12:69487048-69487070 TGTTATGGTTATATAGATGAGGG + Intronic
1098474570 12:70885389-70885411 TTTTATGTTTACATTATGGATGG - Intronic
1098517741 12:71397211-71397233 TTTTATACTAATATTGAGAAAGG - Intronic
1098558050 12:71841083-71841105 TTTTCTTTTTATATTCAGGGTGG + Intronic
1098698905 12:73597517-73597539 TTATAAGATTATTTTGAGGATGG + Intergenic
1099021001 12:77404524-77404546 TTTCATGTCCATATTGAGGTTGG + Intergenic
1099101717 12:78449613-78449635 TTTGACGTTTATATTGAGTGAGG + Intergenic
1099336178 12:81361339-81361361 TATGATGATTATAATGAGGATGG - Intronic
1099463147 12:82948357-82948379 TTTTTTGTTTAAATTAAGGTAGG - Intronic
1099705130 12:86142716-86142738 TTTTTTGTTTTTTTTGTGGAGGG + Intronic
1099852888 12:88125399-88125421 TTTTAGGTTAATATTCATGAAGG - Intronic
1099960712 12:89394477-89394499 TTTTGTATTTTTATTCAGGACGG - Intergenic
1100074309 12:90760233-90760255 TTTTAGTTATATTTTGAGGATGG - Intergenic
1100452292 12:94718951-94718973 TTTTGTTTTTTTAATGAGGAAGG + Intergenic
1100962392 12:99977148-99977170 TTTTGTTTTTATTTTGAGTAGGG + Intronic
1101400225 12:104380755-104380777 TTTCATGTATATATTCATGAGGG + Intergenic
1101622723 12:106404903-106404925 TTTTATATTTGTTTTGAGGTAGG + Intronic
1101623093 12:106409360-106409382 TTTTTTTTTTTTCTTGAGGATGG + Intronic
1101957890 12:109226954-109226976 TTTTTTTTTTTAATTGAGGAAGG + Intronic
1102277669 12:111596025-111596047 TTTTGTATTTTTAGTGAGGACGG - Intronic
1102329525 12:112016882-112016904 TTTTATTTTTTTTTTGAGGCAGG - Intronic
1102368931 12:112364724-112364746 TTTTATTTTTTTATTGAGACAGG - Intronic
1102880845 12:116483333-116483355 TTTTTTTTTTAAATTGAGGCAGG - Intergenic
1103090132 12:118092062-118092084 TTTTATTTTTATTTTGAGGCAGG + Intronic
1103780084 12:123392657-123392679 TTTTATTTTTATATTAGAGATGG - Intronic
1103796761 12:123508386-123508408 TTTTTTGTTTTTTTTGAGGCAGG - Intronic
1104296159 12:127515811-127515833 TATTATGATAATATTGATGAGGG - Intergenic
1104336950 12:127907494-127907516 TGTTATGTTTATGTTCATGAAGG - Intergenic
1105103655 13:16496348-16496370 TTTCATGTCTATAGTGAGAAAGG + Intergenic
1105108189 13:16570039-16570061 TTTCATGTCTATAGTGAGAAAGG + Intergenic
1105109523 13:16591866-16591888 TTTCAGGTCTATAGTGAGGAAGG + Intergenic
1105114664 13:16676277-16676299 TTTCAGGTCTATATTGAGAAAGG + Intergenic
1105116679 13:16709017-16709039 TTTCAGGTCTATATTGAGAAAGG + Intergenic
1105155715 13:17346577-17346599 TTTCACGTCTATATTGAGAAAGG + Intergenic
1105156734 13:17362958-17362980 TTTCATGTCTATAGTGAGAAAGG + Intergenic
1105486719 13:20840213-20840235 TTTTATTTTTATTTTGAGACAGG + Intronic
1105739546 13:23309097-23309119 GTTTTTGTTTCTATTGAGAATGG + Intronic
1105785975 13:23749761-23749783 TTTTATGTTGGCATGGAGGAGGG - Intronic
1106051278 13:26192193-26192215 TCTTATTTTTATATTGAAAATGG + Intronic
1106155044 13:27146755-27146777 ATTTATCTTTATTTAGAGGAGGG - Intronic
1106269959 13:28143114-28143136 GTTTTTGTTTTTTTTGAGGAGGG + Intronic
1106294791 13:28402127-28402149 TTTTTTGTTTAACTTAAGGAAGG - Intronic
1106403835 13:29455973-29455995 TTTTATTTTTATTTTGAGACAGG - Intronic
1106991024 13:35420437-35420459 TTTTTTGTCTATATAAAGGATGG + Intronic
1107475707 13:40733798-40733820 TTTTATATTTTTATTAGGGACGG - Intronic
1107873864 13:44771692-44771714 TTTTATTTTTATTTTTAGCAGGG - Intergenic
1108019152 13:46108657-46108679 TTTTATGTATGTTTTGAGGGAGG + Intergenic
1108035297 13:46284847-46284869 TTTTTTATTTTTATTGAGGCAGG - Intergenic
1108042195 13:46349580-46349602 TATTATGTTTTTCTTGAAGAAGG - Intronic
1108359788 13:49658638-49658660 TTTTTTATTTATATTGAGACAGG - Intergenic
1108544371 13:51477222-51477244 TATTATGATTTTGTTGAGGAAGG + Intergenic
1108602181 13:52004475-52004497 TTTACTGTTTATATTGAGTTGGG - Intronic
1108753528 13:53473312-53473334 TTTAAAGCTTATATTAAGGAAGG + Intergenic
1108774602 13:53750322-53750344 TTTGATGGTTATATGGAGGGCGG + Intergenic
1108905789 13:55470758-55470780 TTTTATATTTATATTCATGAAGG + Intergenic
1109037998 13:57291004-57291026 TTTTATGTTTAGAATGAGGTAGG - Intergenic
1109329341 13:60908798-60908820 ATTTATTTTTAAATAGAGGAGGG - Intergenic
1109828331 13:67753328-67753350 TTTAATGTTTAGGTTGAGGAAGG + Intergenic
1109867806 13:68288446-68288468 TTTTATTTTTATATTCATGAAGG + Intergenic
1110595349 13:77315380-77315402 TTTCAGGTTTATATTCATGAGGG - Intronic
1110709236 13:78631799-78631821 TTTTAAGTTAAAATTGAGGAAGG + Intronic
1110918660 13:81056767-81056789 TTTTATGTTAAGTTTGATGAAGG + Intergenic
1111534483 13:89584627-89584649 TTATATGTGTATATTGGTGAGGG - Intergenic
1111571922 13:90100164-90100186 TTTTATTTTTAAATTGAGATCGG - Intergenic
1111692221 13:91578872-91578894 TTTTATGTTTTTATAGAGACCGG - Intronic
1112082910 13:95995033-95995055 TGTTATGTTTACATTGAGAGTGG - Intronic
1112442591 13:99435064-99435086 TTTTATTTTTATTTTGAGACAGG + Intergenic
1112480101 13:99767312-99767334 TTTTATTTTTCTGTTGGGGAGGG + Intronic
1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG + Intergenic
1113249273 13:108433519-108433541 TTTTATGTTAATATTGTTTATGG + Intergenic
1113291672 13:108913459-108913481 TTTAATGTTTAAATTTAGGTTGG + Intronic
1113455064 13:110442594-110442616 TTCTGTGTTTATGTAGAGGAGGG - Intronic
1113530002 13:111017050-111017072 TTTGATGTTGATGTTGAAGATGG - Intergenic
1113604248 13:111594414-111594436 TTTTACGTTTATATTCAGTGAGG + Intronic
1113730826 13:112640247-112640269 TTTTATTTTGATAATGTGGATGG - Intergenic
1114162453 14:20183952-20183974 TTTTAAGTTCATATTGAGTAAGG + Intergenic
1114208216 14:20593340-20593362 TTTTGTGTTTTTATAGAGAAGGG - Intronic
1114412851 14:22517085-22517107 TTTTATCTTCATTTTGTGGATGG - Intergenic
1114928288 14:27433262-27433284 TTTTATGTTTTTGATAAGGAAGG + Intergenic
1115216432 14:31018071-31018093 TTTTTTTTTTAAATTGAGGCAGG - Intronic
1115248044 14:31316857-31316879 TTTTATTTTTTTATAGAGAAAGG + Intronic
1115372370 14:32632083-32632105 TTTTTTGTTTTTAATGAGGGAGG + Intronic
1115421516 14:33200238-33200260 TTATATGTCTATATTTAGGTTGG - Intronic
1115461046 14:33661233-33661255 CTTTATTTTAATATTAAGGAAGG - Intronic
1115466825 14:33724323-33724345 ATTTTTATTTCTATTGAGGATGG - Intronic
1115586760 14:34821977-34821999 TTTTATTTTTATTTTGAGATGGG - Intronic
1116350441 14:43855619-43855641 TTTTTTTTTTTTTTTGAGGAAGG - Intergenic
1116417066 14:44691232-44691254 TTTTTTTTTTTTTTTGAGGAAGG - Intergenic
1116455284 14:45113529-45113551 TCTTATGTTTACACTGAAGAAGG + Intronic
1116879606 14:50151729-50151751 TTTTTTGTTTATTTTGAGACAGG + Intronic
1117100382 14:52339984-52340006 TTTTATATTTATATAGACCAGGG - Intergenic
1117184142 14:53222839-53222861 TTTTATGTTTATATTCATCAGGG + Intergenic
1117333895 14:54740167-54740189 TTTTATGTTTTTATTTGAGATGG - Intronic
1117942059 14:60978754-60978776 TCTTTTGTTTTTATTGATGAAGG - Intronic
1118132351 14:62981219-62981241 CTTCTTGTTTATACTGAGGAAGG + Exonic
1118372775 14:65152057-65152079 ACTTATGTTTATAGTGAGCAAGG + Intergenic
1118396016 14:65337310-65337332 TTTTATTTTTGTAGAGAGGAGGG - Intergenic
1119828625 14:77680389-77680411 TTCTATGTCTATAATGAGGGTGG + Intronic
1120050982 14:79865807-79865829 TTTTATTTTTTTAGTAAGGAAGG + Intronic
1120327232 14:83046493-83046515 TTTTATCTTTATATTTAAAATGG - Intergenic
1120610464 14:86635391-86635413 TTTTATGAGTATATTGAAGGTGG - Intergenic
1120694179 14:87625576-87625598 GTTTATGTATATATAGTGGAAGG - Intergenic
1121289902 14:92765521-92765543 TTTTGTGTTTTTATAGAGGCAGG - Intergenic
1121291305 14:92777977-92777999 TTTTGTGTTTTTATAGAGGCAGG + Intergenic
1121356021 14:93215682-93215704 TTTTTTTTTTTTTTTGAGGATGG - Intronic
1121500879 14:94436432-94436454 TTTTATGATTTTCTTAAGGAAGG - Intergenic
1121689441 14:95865594-95865616 TTTTAAATATATATTGAGCATGG + Intergenic
1121704369 14:95980460-95980482 TTTTATGTATGTATTGTGAAAGG + Intergenic
1121893095 14:97616459-97616481 TTTTATTTTTTTATTGAGACAGG + Intergenic
1122171916 14:99883524-99883546 TTTTTTTTTTTTTTTGAGGAAGG - Intronic
1122759877 14:104015484-104015506 TGGTATGTTTTTATTGAAGAAGG + Intronic
1122815664 14:104310970-104310992 TTTTATGTCTGTATTCATGAGGG - Intergenic
1122892080 14:104736719-104736741 TTTTTTGTTTATTTTGAGACAGG + Intronic
1123046353 14:105518426-105518448 TTTTATGTCTGTTTTAAGGAAGG - Intergenic
1123206371 14:106717487-106717509 TTTTATGTTTTTTTTGTGAAAGG - Intergenic
1123739354 15:23220749-23220771 TTTTTTTTTTTTTTTGAGGAGGG - Intergenic
1123782319 15:23640684-23640706 CTGTAGGTTTATATTGGGGAGGG + Intergenic
1124290573 15:28449708-28449730 TTTTTTTTTTTTTTTGAGGAGGG - Intergenic
1124292664 15:28467838-28467860 TTTTTTTTTTTTTTTGAGGAGGG + Intergenic
1124703153 15:31935119-31935141 TTTTTTGTTTATATATATGAAGG - Intergenic
1124861861 15:33449633-33449655 TGTTATTTTTATATTCAGCATGG - Intronic
1125876805 15:43155222-43155244 TTTTTTGTTTATTTTGAGACAGG - Intronic
1126025198 15:44439529-44439551 TTTTATGTTTTTTTTGGGGGGGG + Intronic
1126449815 15:48793975-48793997 TATTATATTTATATTGATGCTGG + Intronic
1126638505 15:50802401-50802423 TGTCATGTTTACTTTGAGGAGGG + Intergenic
1127104057 15:55594442-55594464 TTGCATGTTTTTATTGTGGATGG + Intergenic
1127166379 15:56247824-56247846 TTTTATTTTTATATTCAAGTTGG - Intronic
1128484944 15:68075951-68075973 TTTTATGTTTTTAGTGGAGATGG + Intronic
1128786473 15:70401135-70401157 ATTTATGTTTGTGTTGATGAGGG + Intergenic
1128794813 15:70458574-70458596 TTTTTTGTTTTTTTTGAGGCTGG - Intergenic
1129144720 15:73636291-73636313 TTTTATGTTTTTAGTAAAGACGG + Intergenic
1129307688 15:74679576-74679598 TTTTATGTTTACATTCATGGGGG - Intronic
1130351516 15:83096382-83096404 TTTTTTCTTTTTATTGAGGCAGG + Intergenic
1130681643 15:86002054-86002076 TTTTATGTTTTTAGTAAAGACGG + Intergenic
1130858113 15:87859923-87859945 TGATATATTTATATTGAAGATGG + Intronic
1131228875 15:90646315-90646337 TTTTCTGTTTGTTCTGAGGAAGG - Intergenic
1131691784 15:94835216-94835238 TCTTATTTTAAAATTGAGGACGG + Intergenic
1131934029 15:97481834-97481856 TTTTGTGTGTATATGGATGATGG - Intergenic
1131959652 15:97775313-97775335 TTTTGTGTCTATATTTAGAAAGG - Intergenic
1132028776 15:98423813-98423835 TTTAATATTTTTATGGAGGAAGG + Intergenic
1132595051 16:745300-745322 TTTTATATTTTTATTAAAGACGG + Intronic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1133655010 16:7852904-7852926 TTCTATGTTTATATTTTTGAGGG + Intergenic
1133860923 16:9594556-9594578 TTTGATCCTTACATTGAGGAAGG - Intergenic
1133994162 16:10735090-10735112 TATTATGTATATATTCTGGATGG - Intergenic
1134006066 16:10819371-10819393 TTTTATTTTTGTAGAGAGGAGGG + Intergenic
1134129302 16:11637873-11637895 TTTTTTTTTTTTTTTGAGGAAGG - Intergenic
1135033815 16:19059970-19059992 TTTTATTTTTATTTTTAAGATGG - Intronic
1135033833 16:19060207-19060229 TTTTATTTTTTTATTCAGGACGG + Intronic
1135249412 16:20888463-20888485 TTTTTTGTTTGTTTTGAGCAGGG + Intronic
1135677424 16:24428773-24428795 TTTTATTTTTATTGTGAAGATGG + Intergenic
1135713653 16:24741535-24741557 TTTTATGTTTGTATTCATAAGGG + Intronic
1135784954 16:25340371-25340393 TTTTATGTTTTTAGTAAAGACGG - Intergenic
1136163702 16:28438402-28438424 TTTTATTTTTATTTTGAGACAGG - Intergenic
1136199262 16:28676584-28676606 TTTTATTTTTATTTTGAGACAGG + Intergenic
1136215607 16:28790759-28790781 TTTTATTTTTATTTTGAGACAGG + Intergenic
1136260332 16:29070598-29070620 TTTTATTTTTATTTTGAGACAGG + Intergenic
1136465645 16:30441750-30441772 TTTTATATTTTTATTAAAGATGG + Intergenic
1137019233 16:35407101-35407123 TTTTATTTTGAGATTGGGGATGG - Intergenic
1137026318 16:35479162-35479184 TTTTATTTTGAAATTGGGGATGG - Intergenic
1137638849 16:50010722-50010744 TTTTGTGTTTTTAGTGAAGATGG - Intergenic
1137823317 16:51466077-51466099 TTTTATGTTTTTGTAGAGAAGGG + Intergenic
1138056751 16:53842677-53842699 ATTTATATTTATTTTGAGGCAGG + Intronic
1138437759 16:57015097-57015119 TTTTATGTTTTTATTAGAGATGG + Intronic
1138452213 16:57100077-57100099 TTTTGTGTTTTTAGTGGGGATGG + Intronic
1139110425 16:63884119-63884141 ATTTATGTATACATTGTGGATGG - Intergenic
1139452883 16:67045964-67045986 TTTTGTGTTTTTATTGGAGATGG + Intronic
1139536322 16:67576954-67576976 GTATATGTATATATTGGGGAGGG + Intronic
1139694161 16:68661691-68661713 TTTTTTGTTTATTTTGGAGATGG + Intronic
1139892629 16:70263638-70263660 TTTTATGTTTTTTTTGAGACAGG + Intronic
1140099998 16:71907817-71907839 TTTTATTTTTATTTTGAGACAGG + Intronic
1140613272 16:76627119-76627141 ATATATGTGTACATTGAGGAAGG + Intronic
1141060680 16:80865871-80865893 TTTTATATCTATATTTATGAGGG - Intergenic
1141451098 16:84103258-84103280 TTTTTTTTTTTTTTTGAGGAAGG + Intronic
1141871139 16:86786956-86786978 TTTCATGTTGATTTTGAGGTAGG - Intergenic
1142301108 16:89258414-89258436 TTTTATTTTTTTATTGAGTCTGG + Intergenic
1142325158 16:89410133-89410155 TTTTAAATTTAGATTGAGGCTGG - Intronic
1142528869 17:565229-565251 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1142632846 17:1236692-1236714 TTTTTTGTTTTTAGTGAGGATGG - Intergenic
1143643348 17:8212868-8212890 TTTTTTGTTTTTATTGAGACAGG - Intergenic
1143655876 17:8293350-8293372 TTATGTGTTGATATTGAGGTTGG - Intronic
1143909535 17:10236294-10236316 TTTTGTGTTTTTAGTGAAGACGG - Intergenic
1143960232 17:10711188-10711210 TTTTATTTTTTTGTTTAGGAGGG - Exonic
1144027289 17:11289117-11289139 ATTTATTTTTAAATTGAGAATGG + Intronic
1144311022 17:14014509-14014531 TTTTATGTCTACTTTAAGGATGG + Intergenic
1144419312 17:15081716-15081738 TTTTATGTTTATTTTCACCATGG - Intergenic
1145059436 17:19723417-19723439 TTTTTTTTTTTTTTTGAGGAGGG - Intergenic
1145201570 17:20950072-20950094 TTTTTTTGTTATATGGAGGACGG + Intergenic
1146013430 17:29213945-29213967 TTTTATTTTTATTTTGTAGACGG + Intergenic
1146137490 17:30335708-30335730 TTTTTTTTTTTTTTTGAGGAAGG - Intergenic
1146822722 17:35997759-35997781 CTTTATTATTATATTGAGTAGGG + Exonic
1147492874 17:40887404-40887426 TTTTATTTTTATTTTGAGACAGG + Intergenic
1148171376 17:45523548-45523570 TCTTTTGTTTATTTTGAGGCCGG + Intergenic
1148278296 17:46326253-46326275 TCTTTTGTTTATTTTGAGGCCGG - Intronic
1148300507 17:46544108-46544130 TCTTTTGTTTATTTTGAGGCCGG - Intronic
1148625961 17:49069113-49069135 TTATTTGTTTATTTTGAGAAAGG + Intergenic
1148886456 17:50776723-50776745 TTTTATGTTTTTCTTAAAGACGG - Intergenic
1149477373 17:56974427-56974449 TTATATGTTTATTCTGAGAAGGG - Intergenic
1149529183 17:57381071-57381093 TTTTATTTTTATTTTGAGACTGG + Intronic
1149692013 17:58585447-58585469 TTTTATTTTTATTTTGAGACAGG + Intronic
1149811062 17:59672628-59672650 TTTTATTTTTTAATTTAGGATGG + Intronic
1150113066 17:62519199-62519221 TTTTATGTTGATGTGAAGGAAGG + Intronic
1150517941 17:65834171-65834193 TTTTCTTTTTATTTTAAGGAAGG - Intronic
1150534345 17:66020490-66020512 TTAAATGGTTATATTGGGGAAGG - Intronic
1150718371 17:67592270-67592292 TGTTATGTTGCTATTGATGATGG - Intronic
1150751970 17:67872533-67872555 TTTTATGTTTTTAGTAAAGATGG - Intronic
1151687291 17:75655672-75655694 TTTTATTTTTATTTTGAGACAGG + Intronic
1152125378 17:78443553-78443575 TTTTATTTTTATTTTGAGGCAGG + Intronic
1152652692 17:81502972-81502994 TTTCATGTTTTCATAGAGGATGG - Intergenic
1153020565 18:625101-625123 ATTTATGTTAATATTTAGAACGG + Intronic
1153291199 18:3503788-3503810 ATTTATTTTTATTTTGAGGTAGG - Intronic
1153575954 18:6522168-6522190 TTTTATTTTTATTCTGAGGGAGG + Intronic
1153883310 18:9439304-9439326 TTTTTTGTTTATTTTGAGACAGG - Intergenic
1153923606 18:9813046-9813068 TTTTATGTATATTTTGGAGAAGG - Intronic
1153924251 18:9820421-9820443 TTTTATGTCTATATTCATAAAGG + Intronic
1153956796 18:10103085-10103107 TTTTTTTTTTTTTTTGAGGAAGG - Intergenic
1154209816 18:12369704-12369726 TTTTTTTTTTTTTTTGAGGAGGG - Intronic
1154986498 18:21556246-21556268 TTTTATTTTTATTTTGAGTCAGG - Intronic
1155118332 18:22792467-22792489 TTTTATATTTTTAGTGAAGACGG + Intergenic
1155363061 18:25021532-25021554 TTTTTTGTTTTTCTTGAGTATGG - Intergenic
1155505332 18:26527453-26527475 TTTTATGTTTATGTGAAAGAGGG + Intronic
1156014090 18:32527996-32528018 TTTTATATTTTTATTAAAGATGG + Intergenic
1156139458 18:34088812-34088834 CTTTATGTTTTTATTGAGTTAGG + Intronic
1156254775 18:35384526-35384548 TATTATGTTTTTATGGAGCATGG - Intergenic
1156652320 18:39238770-39238792 TTTTATGATTATTTTGGGAATGG + Intergenic
1156652750 18:39244415-39244437 TTGTTTGTTTATATTGCTGAAGG + Intergenic
1156660014 18:39335698-39335720 TTTTATATTTTTATTAGGGATGG + Intergenic
1157062333 18:44306181-44306203 ATTTATTTTTACATTCAGGAGGG + Intergenic
1157091938 18:44646889-44646911 TTTGGTGTTTATATTGAGAAGGG + Intergenic
1157142636 18:45125516-45125538 ATATATGTTAATATTTAGGATGG + Intergenic
1157193223 18:45598489-45598511 TTTTTTATTTTTATGGAGGAAGG - Intronic
1157417811 18:47520662-47520684 TTTTATATATATATAGGGGAGGG - Intergenic
1157655952 18:49388321-49388343 TTTTATTTTTATTTTGAGACAGG - Intronic
1158052253 18:53236745-53236767 TTTTGTGTATAGATTAAGGAAGG + Intronic
1158473662 18:57760682-57760704 TTTTATTTTTTTATTTAAGATGG + Intronic
1158832339 18:61294021-61294043 TTTTATATTTCTGTTGAGGCTGG + Intergenic
1159030948 18:63231187-63231209 TTTTATTTTTAAATTGTGAATGG - Intronic
1159171023 18:64766973-64766995 TATTTTGTTTATATTCAAGAGGG + Intergenic
1159624199 18:70672773-70672795 TTTATTGTTATTATTGAGGATGG - Intergenic
1160159087 18:76457709-76457731 TTTTATTTTTATTTTGAGACAGG - Intronic
1160717531 19:583158-583180 TTTTATGTTTAATTTTATGAGGG + Exonic
1161992886 19:7695005-7695027 TTTCATGTTTTTGTTGAGGCAGG + Intronic
1162074724 19:8178043-8178065 TTTTGTATTTATATTGAAGACGG + Intronic
1162276682 19:9661487-9661509 TTTTATATTTTTAGTAAGGATGG + Intronic
1162480649 19:10925059-10925081 TTTTATATTTTTATTAGGGACGG - Intronic
1163060533 19:14757975-14757997 TTTTATTTTTATTTTTAGTAAGG + Intronic
1163704643 19:18805015-18805037 TTTTATGTAAATATGAAGGAAGG - Intergenic
1163894420 19:20045217-20045239 TTTCATTTTGAGATTGAGGATGG + Intergenic
1164862341 19:31572015-31572037 TTTTATTTTTTTATAGAGAAAGG - Intergenic
1165129991 19:33625869-33625891 TTTTTTTTTTAAATTGAGGTTGG + Intronic
1165828015 19:38716659-38716681 TTTTAAGTTTTTATAGAGAAGGG - Intronic
1166357895 19:42238039-42238061 TTTTATTTTTATTTTAAGGCTGG - Intronic
1166443612 19:42838700-42838722 TTTTATGTCTATATGGGTGAAGG + Intronic
1166463305 19:43009364-43009386 TTTTATGTCTATATGGGTGAAGG + Intronic
1166469447 19:43065922-43065944 TTTTATGTCTATATGGGTGAAGG + Intronic
1166480579 19:43169460-43169482 TTTTATGTCTATATGGGTGAAGG + Intronic
1166527434 19:43521159-43521181 TTTTATGTTTTTATTAGAGATGG - Intronic
1166869216 19:45861080-45861102 TTTTATGTTTTGACTGGGGACGG - Intronic
1166885403 19:45957696-45957718 TTATTTATTTATATTGAGGCAGG - Intronic
1167340065 19:48910246-48910268 TTTTATGTTTTTATTAGAGATGG + Intronic
1167805611 19:51781996-51782018 TTTTATGTTTTTAGTGGAGACGG - Intronic
1167852839 19:52215059-52215081 TTTTATTTTTATTTTGAGACAGG + Intronic
1167881291 19:52460316-52460338 TTTTTTTTTTTTATTGATGATGG + Intronic
1167927934 19:52837106-52837128 TGTTCAGTTTACATTGAGGACGG - Intronic
1168014009 19:53556809-53556831 TTTTATTTTTATTTTGAGACGGG + Intronic
1168231015 19:55031799-55031821 TTTTATGTTTTTATAGAGATGGG - Intronic
1168619338 19:57864919-57864941 TTTTTTGTTTTTTTTGAGGCAGG - Exonic
925454355 2:4002423-4002445 TTTTATGTTGATATGGAGGTAGG + Intergenic
925861849 2:8185959-8185981 TTTTTTGTCTATATTCATGAGGG - Intergenic
926029059 2:9569757-9569779 TTTTTTGTTTGTTTTGAGGCAGG - Intergenic
926778737 2:16447748-16447770 AGTGATGTTTATATTGAAGAAGG + Intergenic
927225581 2:20762584-20762606 ATGTCTGTTTATATTGAGTATGG - Intronic
927778021 2:25917034-25917056 TTTTATGTATATATAGAGAGAGG - Intergenic
927899750 2:26810890-26810912 TTTTCTGTTTATTTTGAGGCAGG + Intergenic
927910527 2:26894986-26895008 TTTTAGGTTTAAATTAAGGCTGG + Intronic
927951213 2:27170846-27170868 TTTTATTTTTATTTTGAGAGGGG + Intergenic
928069102 2:28196849-28196871 TTTTTTTTTTTTTTTGAGGAGGG + Intronic
928194340 2:29204017-29204039 TTTTAGGTTTATTTTCTGGAAGG + Intronic
928793318 2:34985059-34985081 TTTTTTGTTTATTTTTAAGATGG - Intergenic
929061528 2:37929959-37929981 TATTATGTGAATATTGAGGAAGG + Intronic
929322955 2:40567787-40567809 ATTTATGTATATTCTGAGGAGGG + Intronic
929338554 2:40783205-40783227 GTGTGTGTTTATATTGAGAATGG + Intergenic
929688789 2:44057530-44057552 TTTTATTTTTTTATTGAGGTGGG - Intergenic
929843342 2:45495191-45495213 TTTTAGGTTTATTTTGTGGTTGG - Intronic
929959007 2:46482165-46482187 TTTCATGTTTATAATGAAGCAGG - Intronic
930327645 2:49940438-49940460 TTTTATGTTTGCATTCAAGATGG + Intronic
930630184 2:53745200-53745222 TATTATGTGTATATGGAGCAAGG + Intronic
930726644 2:54688063-54688085 TTTTATTTTTATTTTGAGACAGG + Intergenic
931167489 2:59763692-59763714 TTTTGTGTTGCTATTGAGGAGGG - Intergenic
931252258 2:60543430-60543452 TTTTCTTTTTATGATGAGGAAGG - Intronic
931277891 2:60759952-60759974 TTTTATGTTTATGTTTATGAAGG - Intronic
932534755 2:72581546-72581568 TTTTTTATTTAAATCGAGGAAGG + Intronic
932627120 2:73306502-73306524 TTTTATGCTTAAATTGTTGAGGG - Intergenic
932721194 2:74139965-74139987 TTTTATATTTATATAGAGATGGG - Intronic
933381731 2:81556751-81556773 TTTTGTGTTTATTTTTACGAAGG - Intergenic
933423598 2:82083204-82083226 TTGTATGTCTATTTTCAGGATGG - Intergenic
933595338 2:84277782-84277804 TTTTATGCTGATATCCAGGAAGG - Intergenic
933641641 2:84768574-84768596 TTTTATGCTTTTATTGTGGGAGG - Intronic
933949710 2:87318259-87318281 TTTTTTTTTTTTTTTGAGGAAGG + Intergenic
934668413 2:96190646-96190668 TTTTATTTTTTTTTTGAGAAGGG + Intronic
934865128 2:97801945-97801967 TTTTAGGTTTAACTTGAGTAAGG - Exonic
935009089 2:99114265-99114287 TTTTAGGTTTATATTTATGTGGG - Intronic
935683628 2:105662569-105662591 TTTCATTTTTATATTCATGAGGG + Intergenic
935866609 2:107393534-107393556 TTCTATGTTTATATTTAGATAGG + Intergenic
936291703 2:111229725-111229747 TTTTATGTCTATATTCATGAGGG - Intergenic
936463736 2:112729291-112729313 TTTTATGTTTTTATAGAGACAGG + Intronic
936663842 2:114572159-114572181 TGTTATTTTTATAATGAGAAAGG - Intronic
936732072 2:115394777-115394799 TTCTCTGTTTATAGTGAGGTGGG + Intronic
937429650 2:121827420-121827442 TTTTTTTTTTTTTTTGAGGAAGG + Intergenic
938090819 2:128433494-128433516 TTTTATTTTTATTTTGAGACAGG + Intergenic
938110578 2:128561894-128561916 ATTTAACTTTACATTGAGGAAGG + Intergenic
938999810 2:136721287-136721309 TTGTATGTTTACTTTCAGGATGG - Intergenic
939433734 2:142146052-142146074 TTTTATGTTTTTAGTTAGGATGG - Intergenic
939463461 2:142527443-142527465 TTTTATGTTGATATTTATAATGG + Intergenic
939730765 2:145782118-145782140 TTTTATTTTTATTTTTTGGATGG + Intergenic
940476780 2:154171935-154171957 TTTAATTTTTGTATTGAGCATGG - Intronic
941127096 2:161597146-161597168 TTTTATGTCTATATTCATCATGG - Intronic
941131856 2:161660827-161660849 TTTTATTTTTATTTTTAGTAGGG + Intronic
941756437 2:169191505-169191527 TTTAATATTTTTATGGAGGAAGG - Intronic
941785040 2:169488995-169489017 ATTTATGTTTAAATAGAGGTAGG + Intronic
942057039 2:172193993-172194015 TTTTATTTTTATTTTTTGGATGG + Intergenic
942157568 2:173147348-173147370 TTTTTTGTCTGTTTTGAGGAAGG + Intronic
942329301 2:174805359-174805381 TTATAATTTTATATTGAGAACGG - Intronic
942530577 2:176905487-176905509 TTTTATTTTTGTATTTAGGGGGG - Intergenic
942747559 2:179252546-179252568 TTTTCTGTTTTGATAGAGGAAGG - Intronic
943289730 2:186053878-186053900 TTTTATTTTTATTTTGAGACAGG + Intergenic
943493286 2:188583809-188583831 TTGAATGTTTATATTTAAGAAGG + Intronic
943517999 2:188910475-188910497 TTTTATATATATATTAAGAATGG - Intergenic
943584368 2:189720601-189720623 TTTTTTGTTTATTTTTAGAATGG + Exonic
943868541 2:192961341-192961363 TTATATTTCTATATGGAGGAAGG - Intergenic
943976135 2:194480244-194480266 TTGCTTGTTTATTTTGAGGAAGG + Intergenic
944082590 2:195805256-195805278 TTTTTTTTTAATATTGAGGGAGG + Intronic
944972562 2:205010980-205011002 CTGTATGTTTATATTTAAGAAGG + Intronic
945317482 2:208385900-208385922 TTATATGTTTCAATTGAGGAGGG - Intronic
945502158 2:210589663-210589685 TTTTATTTTTATTTTGAGACAGG + Intronic
945684060 2:212947806-212947828 TTTTATATTTTTATTGAGAGTGG - Intergenic
945804032 2:214468185-214468207 TTTTGTGTTTTTATTAAAGACGG + Intronic
945852471 2:215025892-215025914 TCTTATGTTTGTATTGAGGTAGG - Intronic
945966136 2:216189086-216189108 TTTCATGTTTTTAATAAGGAAGG + Intronic
946666369 2:222053843-222053865 TTTTATTTTTATTTTGAGACAGG + Intergenic
947168073 2:227282801-227282823 TTTTGCATTTATATTGAGAAGGG + Intronic
947711745 2:232320377-232320399 TTTCATGTTTATACTGAGGCAGG + Intronic
948203653 2:236148805-236148827 TTTTATTTTTATCTTGAGACAGG + Intergenic
1169372647 20:5040320-5040342 TTTTATTTTTTTTTTGAGGCAGG - Intergenic
1169462993 20:5812878-5812900 TTTTATTTTTTTATTGAGACGGG + Intronic
1169495028 20:6107023-6107045 TTTTATGTTTTTAGTAAAGACGG - Intronic
1169639170 20:7729920-7729942 TTTAATGTATATATTAATGATGG - Intergenic
1169881099 20:10348092-10348114 TTTTAAGTTTATATTGATTAGGG + Intergenic
1170054747 20:12189345-12189367 TTTTGTGTTTATGTTAATGAGGG - Intergenic
1170107433 20:12766857-12766879 TTTTGTGTTTTTAGTAAGGACGG - Intergenic
1170347603 20:15404186-15404208 TTTTTTGTTTTTACTGAGTAGGG + Intronic
1170726021 20:18927458-18927480 TTTTGTCTTTCTATTTAGGAAGG - Intergenic
1171111556 20:22488297-22488319 TTTTTTGTTTACATTCATGAAGG + Intergenic
1171799675 20:29600110-29600132 TTTTATTTTTATTTTTAAGATGG - Intergenic
1171937852 20:31293104-31293126 ATTTTTGTTTCTATTGAAGATGG - Intergenic
1172001696 20:31783131-31783153 TTTTGTGCTTCTTTTGAGGAGGG + Intronic
1172055022 20:32148544-32148566 TTTTTTGTTTTTGTTGAGGTAGG - Intronic
1172285479 20:33737491-33737513 TTTTATATTTTTAGTAAGGATGG + Intronic
1172292377 20:33785346-33785368 TTTTATTTTTATTTTGAGACAGG + Intronic
1172348849 20:34225210-34225232 TTTTGTGTTTTTATTGAGACGGG + Intronic
1172508444 20:35481706-35481728 TTTTATTCTTTTATTGAGGCAGG + Intronic
1172574711 20:35999289-35999311 TTTAATGTTAATATTGATTATGG + Intronic
1173106219 20:40137373-40137395 TTCAATGTTTATATTCAGCATGG - Intergenic
1173489210 20:43465837-43465859 TTTTATTTTTGTCTTTAGGAGGG + Intergenic
1173491349 20:43485063-43485085 TTATTTATTTATATTGAGGCAGG - Intergenic
1173687104 20:44931345-44931367 TTTTTTGTTTATTTTAAAGAAGG + Intronic
1173814875 20:45980794-45980816 TTTTATTTTTATTTTGAGACAGG + Intergenic
1173962014 20:47081374-47081396 ATATATGTATATATTGGGGATGG - Intronic
1174066739 20:47871330-47871352 TTTTATTTTTATTTTGAGATAGG - Intergenic
1174219634 20:48943574-48943596 TTTTTTGTTTATTTTGAGTCAGG + Intronic
1174772239 20:53311356-53311378 TTAGAAGTTTATATTGAGGCAGG - Intronic
1174829562 20:53800219-53800241 TTTTATTTTTATTTTGAGACAGG + Intergenic
1174889975 20:54381260-54381282 TTTTATTTTTTTATTGAGACAGG - Intergenic
1174930502 20:54808747-54808769 CTTTTTGTTTTTATTTAGGAAGG - Intergenic
1175351414 20:58322947-58322969 TTTAATGTTTATATTGAAACAGG - Intronic
1175622304 20:60458339-60458361 ATTTATGTTTATATTGTCTACGG + Intergenic
1175834271 20:61983280-61983302 TTTTTTTTTTGTATTTAGGAAGG - Intronic
1176086890 20:63300132-63300154 TTTTATACTTATATTCATGAGGG + Intronic
1176206341 20:63890655-63890677 TTTTATATGTATATAGATGAGGG + Exonic
1176717460 21:10365080-10365102 TTTTATTTTTATTTTGAGACAGG - Intergenic
1177018859 21:15827251-15827273 TGTAATGTTAATATTGAGAAGGG + Intronic
1177074935 21:16559658-16559680 TTATATGTTAATAATGAGGGCGG + Intergenic
1177081851 21:16649527-16649549 ATTTAAGTTTATATTTAGCAGGG + Intergenic
1177493527 21:21859380-21859402 TCTTAGGTTTATATCGAGGATGG - Intergenic
1177549194 21:22598283-22598305 TTTTATGTCTAGCTGGAGGATGG + Intergenic
1177551668 21:22630628-22630650 TTTTATTTTTATATTTATAAAGG - Intergenic
1177553392 21:22655965-22655987 GTTTCTGTTTATATTTAGAAGGG + Intergenic
1177873510 21:26602404-26602426 TTTTGTGTTTTTATTAAAGATGG + Intergenic
1178098305 21:29238865-29238887 TTTGATTTTTATATTTGGGAAGG + Intronic
1178294650 21:31399003-31399025 TTTTATGTTTTTAGTGGAGATGG - Intronic
1178319250 21:31592507-31592529 TTTTATGTATACAATGAGAAAGG - Intergenic
1178450789 21:32697627-32697649 TTTTGTGTTTTTAATAAGGATGG - Intronic
1178483255 21:32998693-32998715 TTTTATGTCTATATTCAGGAGGG - Intergenic
1178565488 21:33680500-33680522 TTTTGTGTTTTTATAGAGAAAGG + Intronic
1178844639 21:36164315-36164337 TTTTATGTTTTTTTGGAGGCAGG - Intronic
1179220330 21:39401086-39401108 TTTTATTTTTGTAGAGAGGAGGG + Intronic
1179531933 21:42025698-42025720 TTTTATTTTTATCTTCAGCAAGG - Intergenic
1180298687 22:11018000-11018022 TTTTATTTTTATTTTGAGACAGG - Intergenic
1180600886 22:17014917-17014939 TTTTATTTTTATTTTGAGACAGG + Intergenic
1181143552 22:20826170-20826192 TTTTATATTTATAGTGGAGATGG - Intronic
1181418349 22:22776967-22776989 TTTAATGTTTACATTGCAGATGG - Intronic
1182865511 22:33600892-33600914 TTTTATATTTTTATTAAAGACGG - Intronic
1183680321 22:39324846-39324868 TTTTATTTTTATAATGAGACAGG + Intergenic
1184146355 22:42613753-42613775 TTTTATGTTTTTTTTGAGACGGG - Intronic
1184724188 22:46333819-46333841 TTTTTTTTTTTTTTTGAGGAAGG - Intronic
1185251810 22:49806055-49806077 TTTTATGTTTTCAGTGAAGATGG + Intronic
949521715 3:4861665-4861687 TTTTATGTCTATATTCATGAGGG + Intronic
949787185 3:7754789-7754811 CTTTATATTTTTATTCAGGAAGG + Intergenic
949979126 3:9489135-9489157 TTTTATTTTTATTTTGAGACAGG - Intergenic
950350525 3:12346805-12346827 TTTTATTTTTTTATAGAGGCAGG + Intronic
950372115 3:12539953-12539975 TTTTATATTTTTAGTAAGGACGG + Exonic
950697060 3:14709792-14709814 TTTTATGTTTATAGTCATAAGGG + Intronic
950942408 3:16906054-16906076 TTTTTTTTTTTTATGGAGGAAGG - Intronic
950972895 3:17206937-17206959 TTTTATTTGTTTATTGAGGCAGG + Intronic
951168333 3:19508163-19508185 TTTTATGTCTATATTCATCAGGG + Intronic
951205038 3:19917197-19917219 ATTTATATTTATATAGAGGCTGG - Intronic
951288934 3:20851829-20851851 TTTTATGTATATAATGGGAATGG - Intergenic
951512431 3:23518514-23518536 GTTTATGTTTACAGTGAGGAAGG + Intronic
951777894 3:26330022-26330044 TTTTATGTTTATGTTCATCAGGG - Intergenic
951928743 3:27939967-27939989 TTTGATGTTTATTTTGAAGTAGG - Intergenic
951994469 3:28712170-28712192 TTTTTTTTTTAAGTTGAGGATGG + Intergenic
952226088 3:31377719-31377741 GTTTATGTTTACAGTTAGGAAGG - Intergenic
952439551 3:33312060-33312082 TTTTATTTTTATTTTGAGACAGG + Intronic
952560056 3:34581583-34581605 TTTTATGGTTATAATCAGGGAGG - Intergenic
952666729 3:35915711-35915733 TTTTATGTCTATGTTCATGAAGG + Intergenic
952697933 3:36291828-36291850 TTTTATTCTTATTTTGGGGAGGG - Intergenic
953143556 3:40251707-40251729 TTTTGTGTTTATTTTTATGATGG - Intronic
953316810 3:41935529-41935551 TTTTATGTTTTTAGTAAAGATGG + Intronic
953603757 3:44393578-44393600 TATTATGTGTATATGGAAGAGGG - Intronic
953847225 3:46437324-46437346 TTTTTTTTTTTTTTTGAGGAAGG + Intronic
953987500 3:47456395-47456417 TTTTATTTTTATGTTGAGGCAGG - Intronic
954308088 3:49742071-49742093 TTTTATTTTTATTTTGAGACAGG - Intronic
954527232 3:51282908-51282930 TTTTGTGTTTATATTCATAAGGG - Intronic
954773419 3:52995392-52995414 TTTTATTTTTATTTTGAGGCAGG + Intronic
955102846 3:55869012-55869034 TTATATGTTTATAATAAGGAAGG - Intronic
955416663 3:58698570-58698592 TTTTTTGTTTTTTTTGAGGCAGG + Intergenic
955686292 3:61552070-61552092 TTTTATGTCTATTTTGTTGAGGG + Intergenic
955840298 3:63105610-63105632 TTTAATGTTTATATTCAGAGAGG - Intergenic
955962502 3:64355287-64355309 TTTTATGCTGAAATTTAGGAGGG - Intronic
956102358 3:65781897-65781919 TCTTAGGTTTATAGTGAGGGGGG - Intronic
956774230 3:72551569-72551591 TTTTATGTTTTTAGTGGAGACGG - Intergenic
956825785 3:72996266-72996288 ATTTATTTTTATATAGAGAAGGG + Intronic
956934702 3:74087254-74087276 TTTTATTTTTTTATGAAGGAAGG + Intergenic
957415381 3:79895403-79895425 TTTTGTGGTTATACTGAGGTAGG - Intergenic
957799762 3:85061229-85061251 TTCTATGTTTTTATTGACAAGGG - Intronic
958068358 3:88575430-88575452 TTTTATGTGTATATAGAGTAGGG + Intergenic
958545143 3:95538292-95538314 TTTTCTATTTATATTGAAGCAGG - Intergenic
959005893 3:101019588-101019610 TTTTAGGTTTATGTTTAGGATGG - Intergenic
959088855 3:101880944-101880966 TTTTTTGTTTGTAGAGAGGAGGG + Intergenic
959249209 3:103919422-103919444 TTTTATTTTTATATTGGGAGAGG - Intergenic
959469274 3:106729600-106729622 TTTTCTTTGAATATTGAGGAAGG - Intergenic
959866120 3:111272326-111272348 TTCTATGTTTGGATTGATGATGG - Intronic
959995627 3:112677360-112677382 TTGTATGATTTTATTAAGGAGGG - Intergenic
960671473 3:120158818-120158840 TTCTAGGTTTATTTTGAAGATGG - Intergenic
961007155 3:123412779-123412801 TTTTGTTTTTAGCTTGAGGAAGG - Intronic
961065500 3:123871859-123871881 TTTTGTGTCTATATTCATGAAGG - Intronic
961122845 3:124387801-124387823 TTTTATTTTTTTTTTCAGGATGG + Intronic
961219064 3:125185682-125185704 TTTTGTGTATATATTCATGAGGG - Intronic
961420062 3:126796172-126796194 TTTTATGTTTTTATAGAGATGGG - Intronic
961906255 3:130265580-130265602 TTTTATTCTTATAGTGATGAAGG - Intergenic
962576629 3:136760881-136760903 TTTTATATTTTTAGTGAAGACGG + Intergenic
962609125 3:137058317-137058339 TTTTGTATTTTTAGTGAGGATGG + Intergenic
962686951 3:137857128-137857150 TTTTATTTTTGTTTTGTGGAAGG + Intergenic
962757314 3:138475437-138475459 TTTTAGGTTTATTTTTAGGGTGG - Intronic
962762294 3:138526164-138526186 TTTTTTGTTTTTTTTGAGAAAGG + Intronic
962784387 3:138753208-138753230 TTTTATTTTTAAATTGAGACAGG - Intronic
962999987 3:140671358-140671380 TTTTATATTTATATTCATAAAGG - Intergenic
963721488 3:148866925-148866947 TTTTGTGTTTTTAGTGAAGACGG + Intronic
964188186 3:153972352-153972374 TTTCATGGTTATAATGAGGCAGG + Intergenic
964936626 3:162096330-162096352 TTTTATTTTTATTTTGATGTAGG + Intergenic
965107158 3:164371439-164371461 TTTTATTTTTATTTTGAGACAGG - Intergenic
965462282 3:168980989-168981011 TTTTAGTTTTATATTCAAGATGG - Intergenic
966326838 3:178766197-178766219 TTTTATTTTTATTTTGAGATAGG + Intronic
966611657 3:181873913-181873935 TTTTATTTTTATGTTGAGACAGG + Intergenic
967386279 3:188914228-188914250 TTTTTTGTTTGTTTTGAGAAAGG - Intergenic
967799191 3:193636381-193636403 TTTTTTGTTTATTTTTAGGCTGG + Intronic
968242338 3:197101795-197101817 TTTTATTTTTATTTTGAGACGGG + Intronic
968389277 4:175778-175800 TTTGAGGTTTAAATTGAGGAGGG - Intergenic
968415964 4:434123-434145 TTTGATGTTTAAATGTAGGAGGG - Intronic
969034787 4:4244471-4244493 TTTTATTTTTATTTTGAGACAGG - Intronic
969357595 4:6639579-6639601 TTTTTTTTTTTTATTGAGGCAGG - Intergenic
969406603 4:6997320-6997342 TTTTATTTTTATTTTTAGAAAGG - Intronic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
970330045 4:14972477-14972499 TTTTGTGTTTATATTCATGAGGG + Intergenic
970380556 4:15503128-15503150 TTTTATTTTTATTTTTAGTAGGG - Intronic
970602891 4:17654353-17654375 TTTTATATATATATAGAGGGAGG + Intronic
970726466 4:19051284-19051306 TTTTATGTTTATGGTGGGGGAGG + Intergenic
970783146 4:19763771-19763793 TTTTGTGTCTATATTCAGCAAGG + Intergenic
971110728 4:23582570-23582592 TTTTATTTTTATATCAAGGCAGG - Intergenic
971411510 4:26377979-26378001 TTTTATGTATACACTGCGGAAGG + Intronic
971519402 4:27530242-27530264 TTTTATGTTTCTATTTTGGCTGG + Intergenic
971676769 4:29641453-29641475 TTTTTTTTTTCTTTTGAGGAAGG + Intergenic
971718180 4:30208761-30208783 TTTTTTTTTTAAATTGAGTAAGG - Intergenic
971961049 4:33487634-33487656 TATTATTATTATTTTGAGGAAGG + Intergenic
972007085 4:34123022-34123044 TTTTAATTTTATTTTGATGATGG - Intergenic
972370851 4:38421998-38422020 TTGTTTGTTCATTTTGAGGAAGG + Intergenic
973818566 4:54641686-54641708 TTTTTTTTTTTTTTTGAGGAGGG + Intergenic
973867408 4:55127262-55127284 ATTTATTTTTATATAGAGGCAGG + Intergenic
973927611 4:55755345-55755367 ATTTATGTTTATATTGAAGCAGG - Intergenic
974191197 4:58506026-58506048 TTTTTTGTTTATTTTGAGACTGG + Intergenic
974401688 4:61416633-61416655 TTTTTTGTTGTTGTTGAGGAGGG + Intronic
974540729 4:63230900-63230922 TTTTATCTTCACATTGAGTAGGG + Intergenic
974698596 4:65407934-65407956 TTTTTTGTTTTTATTGTGAAGGG + Intronic
975058725 4:69970181-69970203 TTTTATGTTCATACTGAGCCAGG + Intergenic
975241123 4:72060514-72060536 TTTTGTTATAATATTGAGGAGGG - Intronic
975248232 4:72145159-72145181 TTGTGTGTATATATTCAGGAAGG - Intronic
975353766 4:73375340-73375362 TTTTTTTTTTTTAGTGAGGAGGG + Intergenic
975476830 4:74833343-74833365 TTATTTATTTTTATTGAGGAGGG - Intergenic
975896767 4:79102283-79102305 TTTTATGTCTATATTCATCAAGG + Intergenic
976059578 4:81111047-81111069 TTTTATTTTTACATTCATGACGG - Intronic
976517731 4:85989607-85989629 TTATATGTCTATATTCATGAGGG - Intronic
976627524 4:87202879-87202901 TTTTATGTCTGTATTCATGAGGG - Intronic
976800099 4:88980301-88980323 TTTTATCTTTATACTGTGGGGGG + Intronic
976847802 4:89510301-89510323 TTTTATGTTAATTGTGAGGAAGG + Intergenic
977021636 4:91767518-91767540 TATTATGTTTATACCGAAGATGG - Intergenic
977155711 4:93570374-93570396 TCTTAGGTTGATATTGAGGAAGG + Intronic
977201915 4:94126468-94126490 TTCTATGTTTTTCTTGAGGGAGG + Intergenic
977251734 4:94695949-94695971 TTTTATTTTTTTAGTGGGGATGG + Intergenic
977372534 4:96157787-96157809 TTTTTTGTTTATAGTGAGTTTGG - Intergenic
977594429 4:98863131-98863153 TTTAACGTTTTTATTGAGAAAGG - Intergenic
977839999 4:101691162-101691184 TTTTATGTTTTTATAGAGATGGG + Intronic
977965549 4:103143406-103143428 TTTTATTTTTCTATTGATAAAGG - Exonic
978444056 4:108763804-108763826 TTTTTTTTTTTTTTTGAGGATGG + Intergenic
978988530 4:115047626-115047648 TTTTAATTTAATAATGAGGATGG + Intronic
979013584 4:115401846-115401868 TTTTAAATTTATATTTAGGGTGG + Intergenic
979283144 4:118890035-118890057 TTTTATGCTTATATTAAAAATGG + Intronic
979320662 4:119320915-119320937 TTGTTTGTTTATTTTGAGGGTGG + Intronic
979471403 4:121102061-121102083 TTTTTTGTTTCTATTGTGAATGG + Intergenic
979496065 4:121383979-121384001 TTTTATGTATATCTTCATGAGGG + Intergenic
979541318 4:121886708-121886730 TTTTTTGTTTTTTTTGAAGAGGG + Intronic
979747175 4:124231279-124231301 TTTTATGATTATACTGCAGATGG - Intergenic
980182268 4:129415466-129415488 TTTTCTGGTTGTATTGAGTAAGG - Intergenic
980341451 4:131553531-131553553 TTGTATGTTTATATAGTAGAAGG - Intergenic
980690566 4:136291098-136291120 TTTTAAATTTAAATTGAGGTTGG + Intergenic
980806279 4:137818536-137818558 TTTTGTATTTTTATTGGGGACGG + Intergenic
980953771 4:139407940-139407962 TTTTATGTTTTCTTTGGGGAAGG - Intronic
981065211 4:140476498-140476520 TTTTATGGATAGATTGAGGCAGG + Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981168651 4:141594434-141594456 TTTTATATATATATTTAAGAAGG - Intergenic
981184573 4:141785764-141785786 TTTTGTTTTTATTTTGAGGTAGG - Intergenic
981688220 4:147479146-147479168 TTTTATGTTTAATTTTTGGAGGG + Intergenic
981993100 4:150947256-150947278 TTTGGTGTTTATATTCATGAGGG - Intronic
982117532 4:152109961-152109983 TTTTATGTTTTGCTTGAGGATGG - Intergenic
983144646 4:164198426-164198448 ATTTATGTTTTTAATGAGCAAGG + Intronic
983352725 4:166613782-166613804 TTATATTTTTATATTAATGAGGG + Intergenic
983524406 4:168746156-168746178 TTTTATGTTTAAGTGGGGGAGGG - Intronic
983671985 4:170248069-170248091 TATTGTTTTTATATTGAGTACGG + Intergenic
983702350 4:170613660-170613682 TTGTATGTTTATATTGATGTCGG + Intergenic
983830721 4:172323499-172323521 TTTTATTCTTCTATTGAGAATGG + Intronic
984247585 4:177294308-177294330 TTTTATTTTTATTTTGAGACAGG - Intergenic
984666802 4:182437623-182437645 TTTTATGTTTTTAGTGGAGATGG - Intronic
984762368 4:183373889-183373911 TTTTGTGTCTATATTCATGAGGG + Intergenic
984770123 4:183430207-183430229 TTTTATATTTATTTTGAGACAGG + Intergenic
984825454 4:183920119-183920141 TTTTATTTTTATTTTGAGACAGG + Intronic
985227345 4:187776538-187776560 TGATATGCTTTTATTGAGGAAGG - Intergenic
985290008 4:188377334-188377356 TTTTTTTTTTTTTTTGAGGAAGG - Intergenic
985650773 5:1106280-1106302 TTTTATATTTATAGTGCAGATGG - Intronic
986320429 5:6628031-6628053 TTTAATGTCTAGATTGAGGATGG - Intronic
986833920 5:11612892-11612914 TTATTTATTTATATTGAGGCAGG - Intronic
987213962 5:15713567-15713589 TTATAGGTTTATATTGGTGAAGG + Intronic
987516058 5:18910134-18910156 TTTTCTGTTTATATTTAACACGG - Intergenic
987853720 5:23390592-23390614 TTTTTTGTTTGTCTTGAGAAGGG - Intergenic
988059026 5:26142354-26142376 TTTTATTTTTATTTTGAGACAGG - Intergenic
988072472 5:26311283-26311305 TTTTCTTTTTATATTCATGAGGG + Intergenic
988118537 5:26928368-26928390 TTTTATGTTCATAGTTTGGAAGG + Intronic
988216610 5:28282796-28282818 TTTTATTTTTAGATTGACAATGG + Intergenic
988465313 5:31485174-31485196 TTTTATTTGTATACTGAGAAGGG - Intronic
988653123 5:33175586-33175608 TTCTAGGTCTATATTGATGAAGG + Intergenic
988656449 5:33217203-33217225 TTTTATTTTTATTTTTAAGATGG + Intergenic
988663456 5:33299040-33299062 TTTTATGTTTAAATTGATAAAGG + Intergenic
988896951 5:35685854-35685876 TTTTTTTTTTTTTTTGAGGAAGG - Intronic
988937017 5:36094402-36094424 TTTAATGTTAATTTTGATGAAGG - Intergenic
989236556 5:39154675-39154697 TTTTATATTTTTATTGGAGACGG + Intronic
989480207 5:41922252-41922274 TTTTATATATATTTTGAGGGAGG - Intergenic
989553519 5:42763864-42763886 TTTTATTTTTATAATGGAGAAGG + Intronic
989727796 5:44607805-44607827 TTTTATGCCTATATTGCTGAGGG - Intergenic
989962115 5:50428898-50428920 TTTTATTTTTATTTTGAGATGGG + Intronic
990256287 5:53973938-53973960 TTTTATGTTGACTTTGAGTAAGG + Intronic
990582601 5:57179953-57179975 TGATATGTTAAAATTGAGGAAGG + Intronic
991178380 5:63718578-63718600 TTTTATGTTTCTTTTGTGGCAGG - Intergenic
991244456 5:64494795-64494817 TTTTTTGTTTATATTCACAAAGG + Intergenic
991252705 5:64581205-64581227 TTTTATGTATATTTTGAGATGGG - Intronic
991326774 5:65442615-65442637 TTTTAGATTTATATTTATGAGGG - Intronic
991338365 5:65576546-65576568 TTTTATGTTTTTAGTGGAGACGG + Intronic
991730027 5:69576847-69576869 TTTTGTATTTTTAGTGAGGACGG - Intronic
991806461 5:70431990-70432012 TTTTGTATTTTTAGTGAGGACGG - Intergenic
991864925 5:71051015-71051037 TTTTGTATTTTTAGTGAGGACGG + Intronic
993310860 5:86330492-86330514 TTTTGTCTTTATAATAAGGATGG - Intergenic
993313189 5:86363857-86363879 TTTGATGTTACTTTTGAGGATGG - Intergenic
993671060 5:90762510-90762532 TTTTCTGTTTGTATAGCGGATGG + Intronic
993769447 5:91907004-91907026 TAATATTTTTAGATTGAGGATGG + Intergenic
993855722 5:93072287-93072309 CTTAAGGTTTATACTGAGGAAGG + Intergenic
994504466 5:100624064-100624086 TTTTATATTTATAATGATGTTGG + Intergenic
995002011 5:107144489-107144511 TTTCATGGTTATACTGAGAAAGG - Intergenic
995458306 5:112375358-112375380 TTTTTTTTTTAAATAGAGGAAGG - Intronic
995648264 5:114338485-114338507 TTTTATCTATAAAGTGAGGATGG - Intergenic
995981326 5:118107895-118107917 TTTTATGATTGTGATGAGGAAGG + Intergenic
996111541 5:119571670-119571692 TTTTATTTTTAGATTTAGAAAGG + Intronic
997307835 5:132852536-132852558 ATTTATGTATTTATTGAGGCAGG - Intergenic
997552692 5:134767509-134767531 TTTTATGTTTTTAGTGGAGATGG + Intronic
997607962 5:135190403-135190425 TTTTATATTTGGATTTAGGAAGG - Intronic
998375585 5:141688494-141688516 TTTTGTGTTTTTAGTAAGGACGG + Intergenic
998439947 5:142150226-142150248 ATTTATGTTTATAATGAGTCTGG + Intronic
998516023 5:142755120-142755142 TTTTATTTTTATTTTGAGATAGG + Intergenic
998621264 5:143796677-143796699 TTTATTGTTTATATTAAGGTGGG + Intergenic
998746373 5:145264459-145264481 TTTTATGCCTATTTTGTGGAGGG - Intergenic
999038171 5:148376858-148376880 TTTTATTTAAATATTTAGGAAGG + Intergenic
999048636 5:148497191-148497213 TTTTATTTTTATTTTGAGACAGG + Intronic
999885460 5:155918116-155918138 TTTTCCATTTATTTTGAGGAAGG - Intronic
999967695 5:156827031-156827053 TTTTCTCTTTATTTTAAGGAGGG - Intergenic
1001625177 5:173126309-173126331 TTTTGTGTTTTTACTGGGGATGG + Intronic
1002215383 5:177628156-177628178 TTTTATATTTTTATTGGAGACGG - Intergenic
1002507376 5:179689080-179689102 TTTTATTTTTATTTTTAGTAGGG - Intronic
1003204569 6:3995224-3995246 TTTTATTTTTATTTTGAGACAGG - Intergenic
1003436784 6:6097116-6097138 TTTTGTGTCTATATTTATGAGGG + Intergenic
1003856126 6:10277645-10277667 TTTTGTGTCTATATTCATGAGGG - Intergenic
1004435660 6:15590567-15590589 TTTTATATTTTTAATGGGGAAGG - Intronic
1004595377 6:17094551-17094573 TTTTATTTTTATTTTGAGACAGG + Intergenic
1004637730 6:17485190-17485212 TTTTATGTGAATATTTATGAGGG + Intronic
1004686492 6:17951425-17951447 TTTTTTTTTTAAATTGAGGCTGG - Intronic
1004787393 6:18984453-18984475 TTTTATTTTAAAATTGGGGAAGG + Intergenic
1005022899 6:21434500-21434522 TTTTTTGTTTTTTTTGAGGTGGG - Intergenic
1005244486 6:23866354-23866376 TTTTTTGTATCTATTGTGGAAGG - Intergenic
1005518193 6:26574297-26574319 TTTTTTTTTTTTTTTGAGGAAGG - Intergenic
1005522992 6:26616255-26616277 TTTTGTGTCTATATTTATGAAGG - Intergenic
1006480415 6:34288553-34288575 TCTTCTGTTTTTATTGAGGGTGG - Exonic
1007149941 6:39680012-39680034 TTGTTTGTTTATTTTGAGGCAGG + Intronic
1007551050 6:42729742-42729764 TTTTATTTTTATTTTGAGACAGG - Intergenic
1008064422 6:47032162-47032184 TTTTATTTTTTTAAGGAGGAGGG - Intronic
1008108167 6:47462988-47463010 TTTTGTATTTTTATTGGGGATGG + Intergenic
1008344339 6:50407781-50407803 TTTAATTTTTAAATTAAGGAAGG - Intergenic
1008904109 6:56657514-56657536 TTTCCTTTTTAAATTGAGGAAGG - Intronic
1008939158 6:57027532-57027554 TTTAATATTTTTATTGAGAAAGG + Intergenic
1009438509 6:63646887-63646909 TTTTTTTTTTTTAATGAGGAGGG + Intronic
1009459617 6:63896491-63896513 TGGGATGTTGATATTGAGGAAGG - Intronic
1009479683 6:64141083-64141105 TTTTAAGTTCATTTAGAGGAAGG + Intronic
1009597898 6:65759729-65759751 ATTTGTGTTTATATTGAATACGG - Intergenic
1009600075 6:65787529-65787551 TTTTTTTTTTTTTTTGAGGAGGG + Intergenic
1009815566 6:68729400-68729422 CTTTCTGTTTATCTTGATGATGG - Intronic
1009984153 6:70762669-70762691 TCTTATGTTAATAATTAGGAAGG + Intronic
1010326422 6:74568304-74568326 TTTTATGGTGATATTGAAAAAGG + Intergenic
1010442131 6:75906668-75906690 TTTTTTGTTTTTTTTGAGAAGGG - Intronic
1010661464 6:78576061-78576083 TTTTATGGTTATATTAAAGATGG - Intergenic
1010708386 6:79141849-79141871 TTTTATTTTTATATCTAGAAGGG + Intergenic
1010726802 6:79344307-79344329 TTTTATGTTTATAGAGAACAGGG - Intergenic
1010850686 6:80772731-80772753 TGTTATGTTTATTTGGGGGAAGG - Intergenic
1010866511 6:80982436-80982458 TTTTATTTTTATATTTTGAAGGG - Intergenic
1010873592 6:81072241-81072263 TTATATTTTTATATTTATGAAGG - Intergenic
1010902667 6:81446948-81446970 CTTTTTGTGTATGTTGAGGAGGG - Intergenic
1011612600 6:89168122-89168144 TTGTTTGTTTATTTTGAGAAAGG + Intergenic
1011693582 6:89891984-89892006 TTTTTTTTTTTTTTTGAGGAAGG + Intergenic
1011834126 6:91408855-91408877 TTTTTTGTTTTTATTTAAGATGG - Intergenic
1012027157 6:94010144-94010166 TTTTATATTTTTAGTGGGGATGG - Intergenic
1012182306 6:96169524-96169546 TTTTGTTTTTATATTGGGGGAGG + Intronic
1012658668 6:101858266-101858288 ATTTCTATTTATATAGAGGAGGG + Intronic
1012898294 6:104977032-104977054 TTTTATTTTTTTTTTGAGGCAGG + Intronic
1013396856 6:109749578-109749600 TTTTATTTTATTATTGAGGCAGG - Intronic
1013445090 6:110217099-110217121 TTTTATTTTTATTTTGAGATAGG - Intronic
1013530570 6:111016280-111016302 ATTTATATTTATATTGTGGTAGG - Intronic
1013726247 6:113099786-113099808 TTTTGTGTCTATATTCAGGAGGG - Intergenic
1015000577 6:128209542-128209564 TTTAATGTGTAGAATGAGGAGGG - Intronic
1015101024 6:129480679-129480701 TTTTAATTTTATACTGAGCAAGG + Intronic
1015172950 6:130274762-130274784 TTTGGTGTTTCTGTTGAGGAGGG + Intronic
1015932053 6:138370861-138370883 GTTTATGTTTTGATTGAGAAGGG + Intergenic
1016192868 6:141292616-141292638 TTTTATTTTTATTTTGCAGAAGG + Intergenic
1016331577 6:142957943-142957965 TTTTTTTTTTTTTTTGAGGAGGG - Intergenic
1016450150 6:144174375-144174397 TTTTATTTTTATTTTGAGACAGG + Intronic
1016451633 6:144188896-144188918 TTTTATGTTTTTAGTAAAGACGG + Intergenic
1017379526 6:153812896-153812918 TTTTAACTTCATATTGATGAAGG + Intergenic
1017476492 6:154799282-154799304 TTTTATTTTTATATAGAGACAGG + Intronic
1017496019 6:154984285-154984307 TTTTTTGTTTTTATTGAGATGGG + Intronic
1018362513 6:163086466-163086488 TTCTATGGTTATATTTAGGTTGG + Intronic
1018997470 6:168720944-168720966 TTTTTTTTTTTTTTTGAGGACGG + Intergenic
1019846094 7:3503504-3503526 TTTTAACTTTTTATAGAGGAAGG - Intronic
1020205156 7:6108773-6108795 TTTTTTTTTAATATTGAGGCTGG - Intronic
1020375922 7:7486860-7486882 TTTTATGTCTATATTCACAAGGG + Intronic
1020376272 7:7490979-7491001 TTTAATGTGTTTATGGAGGAAGG + Intronic
1020423132 7:8032974-8032996 TTTTATATTTATATTCAAGATGG - Intronic
1020442235 7:8230444-8230466 GTTGATGTTTATAGAGAGGATGG - Intronic
1020601836 7:10285140-10285162 ATTTAGGTTTGCATTGAGGAAGG + Intergenic
1021103223 7:16607559-16607581 TTTTATTTATTTATTGAGGGGGG - Intronic
1021314137 7:19125075-19125097 TTTTATTTTTTTTTTGGGGATGG - Intergenic
1021421039 7:20444794-20444816 TTTTATGGTTATAATTTGGAGGG - Intergenic
1021612401 7:22471025-22471047 TTTCATCTTTAAATTGAGTAAGG + Intronic
1021721817 7:23511923-23511945 TTTTGTGTCTATAATGAGGAAGG - Intronic
1022180191 7:27911605-27911627 TTTTATGTTTCTATTCAATATGG - Intronic
1022406051 7:30091318-30091340 TTTTATTTTTTAATGGAGGATGG + Intronic
1022560957 7:31348685-31348707 TTTTTGGTTTATTTTGGGGAGGG - Intergenic
1023217401 7:37878372-37878394 TTTTGTGTCTATATTCAGGAGGG + Intronic
1023325210 7:39047457-39047479 TTTTATGTTACTATTGTGAATGG + Intronic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024489485 7:49962218-49962240 TTTTGTGTCTATATTCATGAGGG - Intronic
1024979935 7:55148943-55148965 TTTTATGTTTATGTTGAAGTTGG + Intronic
1025013600 7:55420056-55420078 TTTTATGTTTTTTTTGAGACAGG - Intronic
1025151419 7:56555229-56555251 TTTTATGTATTTAGGGAGGAAGG + Intergenic
1025215450 7:57052213-57052235 TTTTTTGTTTATTTTGGAGATGG + Intergenic
1025626197 7:63224640-63224662 TTTTTTGTTTATTTTGGAGATGG + Intergenic
1025655925 7:63518489-63518511 TTTTTTGTTTATTTTGGAGATGG - Intergenic
1025749255 7:64278386-64278408 TTTTAGGTATCTATTCAGGAGGG + Intergenic
1025952412 7:66155831-66155853 CTTTATTTTTAAATTGAGGCTGG - Intergenic
1026288504 7:68985044-68985066 TTTTATTTTTATTTTGAGACAGG + Intergenic
1026345560 7:69470920-69470942 TTTTTTGTTTATTTTGAGATGGG - Intergenic
1026973836 7:74484285-74484307 TTTTATTTTTAAATTGAGACAGG + Intronic
1027129730 7:75582338-75582360 TTTTTTGTTTGTTTTGAGGTAGG - Intronic
1027145920 7:75694507-75694529 TTTTTTTTTTTTTTTGAGGAGGG + Intronic
1027617327 7:80439382-80439404 TTTACTTTTTATATTAAGGATGG - Intronic
1027644792 7:80784258-80784280 TTTTTTTTTAATCTTGAGGAAGG - Intronic
1027667837 7:81061049-81061071 TTTTATTTTTTTATAGAGGCAGG - Intergenic
1027914368 7:84296979-84297001 TTTTATTTTTATTTTTGGGATGG + Intronic
1027982636 7:85245575-85245597 TTTCATGTGTATACTGAGGATGG - Intergenic
1028431993 7:90758294-90758316 TTTTATGTTTAGATGGGGGGTGG + Intronic
1028520624 7:91726562-91726584 TTTTTTTTTTTTTTTGAGGAAGG - Intronic
1029146411 7:98449317-98449339 TTTCACGGTTATGTTGAGGATGG + Intergenic
1029177654 7:98676192-98676214 TTTAATTTTTATACTGAGGAGGG + Intergenic
1029367044 7:100123169-100123191 TTTTGTGTTTTTATTAAAGACGG - Intronic
1029435072 7:100559415-100559437 TTTTATTTTTATATTTCTGAGGG + Intronic
1030003787 7:105095287-105095309 TTTTGTATTTATATTTATGATGG + Intronic
1030089431 7:105844301-105844323 TTTTATGTCTATGTTCAGAAGGG - Intronic
1030138010 7:106276670-106276692 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1030302824 7:107991581-107991603 TTTTTTTTTTTTTTTGAGGATGG - Intronic
1030338740 7:108353356-108353378 TTTTATTTTTATTTTGAGACAGG + Intronic
1030399219 7:109027667-109027689 CTTTATGTGTATATTGGGTAAGG - Intergenic
1030410556 7:109173520-109173542 ATTTTTCTTTATCTTGAGGAAGG - Intergenic
1030717773 7:112830546-112830568 TCTCATGTATATCTTGAGGAAGG + Intronic
1030926505 7:115462011-115462033 CTTTTTGTTTATATTTAGGTAGG - Intergenic
1031215946 7:118891436-118891458 TTTTATGATTAGATTTTGGAAGG + Intergenic
1031332577 7:120484256-120484278 TTTTACTTTTAGATTTAGGAAGG + Intronic
1031371088 7:120967511-120967533 TTTTTTATTTATATTTAGAAAGG + Exonic
1032042272 7:128573140-128573162 TTTTATGTTGATGTGAAGGAAGG + Intergenic
1032371294 7:131356068-131356090 TTTTTTTTTTTTTTTGAGGAAGG + Intronic
1033536455 7:142316734-142316756 TTTTATGTGTATATTGCACAGGG + Intergenic
1033876746 7:145829396-145829418 TTTTTTGTTGAGATTGTGGAGGG - Intergenic
1033904587 7:146186740-146186762 ATTTATTTTTGTATTGTGGATGG + Intronic
1034144657 7:148858340-148858362 TTTTATTATTATTTTGAGGCAGG + Intronic
1034228897 7:149503865-149503887 TTTTATGTTTTTTTTGAGACAGG + Intergenic
1035440388 7:158892445-158892467 TTTTATATTTATTTTGAGTCAGG + Intronic
1036562444 8:9908112-9908134 GGTTTTGTTTAGATTGAGGACGG + Intergenic
1036674978 8:10823820-10823842 TTTTATTTTTATTTTGAGACAGG - Intronic
1037021199 8:13973571-13973593 TTTTAAGGTCATAGTGAGGATGG + Intergenic
1037307704 8:17522862-17522884 TTTTATTTTTTTATAGAGGTAGG - Intronic
1037513684 8:19609185-19609207 TTTTATATTGAGATTGAGGGAGG + Intronic
1037593855 8:20337230-20337252 TTTTATGCTAATTTTGAGGTGGG - Intergenic
1038330651 8:26605724-26605746 TTTTATGTTGCTATTGTGTATGG - Intronic
1038570343 8:28656936-28656958 TTTTTTGTTTATTTTGAGACAGG + Intronic
1038743407 8:30235251-30235273 TTTTCTGTTTTTACTGAGAAAGG - Intergenic
1038808446 8:30815289-30815311 TTTTATGTATGTATTGAGACAGG - Intergenic
1039084343 8:33764977-33764999 TTTTATGTCTTTACTGATGAAGG - Intergenic
1039575131 8:38617184-38617206 TTTCATGTTTATATTAATCATGG - Intergenic
1039815354 8:41089551-41089573 TTTTATTTTTTTTTTGAGGTAGG + Intergenic
1040068493 8:43169328-43169350 TTTTATGTTTATATTGAGGAAGG + Intronic
1040485533 8:47868102-47868124 TTTTGTGTTTATATTCATGAAGG + Intronic
1040591947 8:48801291-48801313 TTTTATGTTCATGTATAGGAAGG + Intergenic
1040845772 8:51837783-51837805 ATTTATTTTTATTTTGAGAAGGG + Intronic
1040958008 8:52999766-52999788 TTTTATGTTTATATATAGTCTGG - Intergenic
1041082771 8:54229166-54229188 TTTTATTTTTATATAGAGACGGG + Intergenic
1041507488 8:58616334-58616356 TTTTATATCTATATTGATGAGGG - Intronic
1041720657 8:60972385-60972407 TTTTAAGTTTAGTTTGAAGAGGG - Intergenic
1042265315 8:66902383-66902405 TTTTTTTTTTAAATTGAGAAGGG - Intronic
1042563576 8:70091704-70091726 TTTTTTTTTTTTTTTGAGGAAGG + Intergenic
1042912082 8:73838228-73838250 ATTTATTTTTATGATGAGGAAGG - Intronic
1043233174 8:77828775-77828797 TTTTGTGTCTATATTGATCAGGG + Intergenic
1043237755 8:77890289-77890311 TTTTTTTTTTAGATTGGGGATGG - Intergenic
1043620426 8:82184702-82184724 TTTAATGATTAGTTTGAGGAAGG - Intergenic
1043624687 8:82241779-82241801 TTTTCTGTTTGTAATGAAGATGG - Intergenic
1043971713 8:86536854-86536876 GGTTATGTGTGTATTGAGGATGG + Intronic
1043995612 8:86811576-86811598 TTTTATATTTTTATTAAAGATGG + Intergenic
1044153532 8:88813637-88813659 TTTTGTGTCTATATTGATCAGGG - Intergenic
1044573929 8:93748345-93748367 TTTTATATTTACTTTGAGAAAGG - Intergenic
1044868703 8:96597475-96597497 TTGCCTGTTTATATTGAAGAGGG - Intronic
1044917025 8:97125452-97125474 TTTTGTGTCTATATTTATGAAGG - Intronic
1044936126 8:97295027-97295049 TTCTATTTTTATTTTGAGGATGG - Intergenic
1044937994 8:97311514-97311536 TTTTCTCTTTTCATTGAGGAAGG + Intergenic
1045396989 8:101771094-101771116 TTTTATTTTTATTTTTTGGAGGG - Intronic
1045612643 8:103864077-103864099 TTTTGTGTTTTTAGTAAGGATGG + Intronic
1045719771 8:105094769-105094791 TTTTATGGTTATCTTGAGTTTGG + Intronic
1045811442 8:106224505-106224527 TTTTATCTTTAAATTGGGGCAGG + Intergenic
1045933825 8:107656088-107656110 TTTTATGTCTAGCTGGAGGATGG + Intergenic
1046171852 8:110518858-110518880 TTTTATGTTGATAATGTGAATGG + Intergenic
1046207441 8:111019401-111019423 TTTTATTTTCTTATTGAGGTTGG - Intergenic
1047167692 8:122458494-122458516 ATTTTTATTTTTATTGAGGATGG + Intergenic
1047814575 8:128448846-128448868 TTAGATGATGATATTGAGGAGGG + Intergenic
1048488038 8:134866861-134866883 TTCCATGTTTATTTTGAGAATGG + Intergenic
1048733208 8:137467475-137467497 TTTTATTTTTTTTTAGAGGAGGG + Intergenic
1048900283 8:139031107-139031129 TTTTATGTATGCATTGAAGAAGG + Intergenic
1049153040 8:141048036-141048058 GTTTATGTTTATTTTGAGGTTGG - Intergenic
1050136010 9:2465554-2465576 TTTTATTTTTATATTTTGTAAGG + Intergenic
1050266059 9:3891059-3891081 TTTTTTTTTTTTTTTGAGGAAGG - Intronic
1050304063 9:4288858-4288880 TTTTATTTTTGTCTTGAGGCTGG - Intronic
1050378288 9:4996561-4996583 TTTTTTGGTTTTTTTGAGGAGGG + Intronic
1050499016 9:6274769-6274791 TTTTGAGTTGATATTCAGGAAGG - Intergenic
1050730028 9:8698600-8698622 TTTTATCTTTAAACTCAGGAAGG + Intronic
1050836599 9:10088534-10088556 TTTTCTGTCTATATGGAAGAAGG + Intronic
1051073433 9:13202031-13202053 TTGTATTTTTACATTGATGATGG + Intronic
1051092697 9:13428604-13428626 TTTTATGTTTACATTAGGGAGGG - Intergenic
1051094391 9:13449295-13449317 TTATACGTTTATTTTGAGCATGG + Intergenic
1051403450 9:16708450-16708472 TTGTATGTGTGTGTTGAGGAGGG - Intronic
1051909222 9:22133867-22133889 ATTTTTGTTTATATTAAGTAAGG - Intergenic
1052460154 9:28752737-28752759 CTTTATGTTTAAGATGAGGAGGG - Intergenic
1052515892 9:29479025-29479047 TTTTATTTTCATTTTGATGATGG + Intergenic
1052659059 9:31404790-31404812 TTTTATGTGTATGTTCATGAGGG + Intergenic
1052925976 9:34016558-34016580 TTTTATTTTTTTTTTTAGGAAGG + Intronic
1053332376 9:37225510-37225532 TTTTGTGTCTATATTCATGAAGG - Intronic
1053477026 9:38389837-38389859 TTTTTTTTTTTTTTTGAGGAGGG + Intergenic
1053522988 9:38800239-38800261 TTCTATGCTTATTTTGTGGAAGG + Intergenic
1054195215 9:62024660-62024682 TTCTATGCTTATTTTGAGGAAGG + Intergenic
1054643193 9:67564029-67564051 TTCTATGCTTATTTTGAGGAAGG - Intergenic
1055152776 9:73022972-73022994 ATTTATGTTTAAAGTGAAGAGGG + Intronic
1055170902 9:73256185-73256207 TTTTATGTTTATATTCAGGAAGG - Intergenic
1055993203 9:82130105-82130127 TTTTATGTTTTTATGGACGGCGG - Intergenic
1056147668 9:83749835-83749857 TTCTACGTTTATATTCAGTATGG - Intronic
1057066100 9:92053402-92053424 TTTTATGTATATATCTAGCAGGG - Intronic
1057407276 9:94784618-94784640 TTTTATTTTTATTTTGGAGATGG + Intronic
1057473394 9:95378557-95378579 TTTTATGTTCAAATTGATAAGGG - Intergenic
1057484810 9:95474560-95474582 TTTTATGTTTCTTTTGGGGCTGG + Intronic
1057537305 9:95924775-95924797 TTTTATTTTAATTTTTAGGAGGG + Intronic
1057860013 9:98633667-98633689 TCTTCTGGTGATATTGAGGATGG - Intronic
1057876826 9:98762799-98762821 TTTTATATTTATATTCATGAGGG + Intronic
1058020368 9:100079761-100079783 TTTTATGTTTACAGTGAGAGAGG - Intronic
1058258937 9:102806737-102806759 TTTTACTTTAATTTTGAGGAAGG - Intergenic
1058572572 9:106363370-106363392 TTTTTTTTTTTTTTTGAGGAGGG + Intergenic
1059159006 9:112016103-112016125 TTTTATTTTTATTTTGGAGATGG + Intergenic
1059173779 9:112150938-112150960 TTTTATTTTTATATAGAGACAGG + Intronic
1059186818 9:112281496-112281518 TTTTATGTCAATATTCATGAAGG + Intronic
1059286227 9:113173992-113174014 TTTTAAGCTTATAATGAGAAAGG + Intronic
1059370601 9:113829599-113829621 TTTTATATCTATATCGATGAGGG - Intergenic
1060000880 9:119957729-119957751 TTTTATTTTTTAATTCAGGAAGG + Intergenic
1060627770 9:125128890-125128912 TTTTATATTTTTAGTAAGGATGG - Intronic
1060674186 9:125497224-125497246 TTTTAAGGTTATACTGAGGAAGG - Intronic
1060728078 9:126019052-126019074 TTTTATGTTTTTAGTAAAGATGG - Intergenic
1060828113 9:126697805-126697827 TTTTCTGTGTATATGCAGGATGG + Exonic
1061023751 9:128034152-128034174 TTTTATTTTTATTTTTAGTAGGG - Intergenic
1061096260 9:128458280-128458302 TTTTATGTTTCTAGTAAAGACGG - Intronic
1061640167 9:131947668-131947690 TTTTTTTTTTCTTTTGAGGAGGG - Intronic
1061760119 9:132845208-132845230 TATTATGATTATTTTGATGATGG - Intronic
1061847643 9:133396860-133396882 TTTCATGTTTCTATGGAGGCAGG + Intronic
1062263623 9:135676337-135676359 TTTTATTTTTATTTTGAGACAGG + Intergenic
1185575434 X:1168671-1168693 TTTTAAGTTTCTATTGAGGCCGG - Intergenic
1185862280 X:3590889-3590911 TTTTTTGTTTTTTTTGAGGCAGG + Intergenic
1186033404 X:5393925-5393947 TTTTTTTTTTTTTTTGAGGAAGG + Intergenic
1186292508 X:8115684-8115706 TTGTTTGTTTTTATTGAGGCAGG + Intergenic
1186439793 X:9575931-9575953 TTTTACCTTTAAATGGAGGAGGG + Intronic
1186703279 X:12114757-12114779 TTATATGTTTATTTTAAAGACGG - Intergenic
1187196896 X:17095528-17095550 TTTTTTTTTTTTAATGAGGATGG + Intronic
1187327654 X:18306839-18306861 TTTTATTTTTATAGAGATGAGGG + Intronic
1187790194 X:22942197-22942219 TTTTGTGTTTGTTTTGAGGCAGG + Intergenic
1188436569 X:30166928-30166950 TTTTGTGTTACTATTGAGAATGG + Intergenic
1188855473 X:35189537-35189559 TTTTATTTTTATTTTCAAGAAGG + Intergenic
1188890366 X:35604651-35604673 TTTTATATTAAGATTGATGAAGG - Intergenic
1189031554 X:37457213-37457235 TTTTATGTTTATACTAGGTAGGG + Exonic
1189466489 X:41281521-41281543 TTTTATTTTTATTTTGAGACAGG - Intergenic
1189996020 X:46638929-46638951 TTTTATGTCTGTATTCATGAGGG - Intronic
1190489597 X:50968544-50968566 TTTTTTTTTTATTTTGAGGCAGG + Intergenic
1191883040 X:65861164-65861186 TATTGTGTTTATATAAAGGAGGG + Intergenic
1192081241 X:68049927-68049949 ATTTATGTTTAAATTGTGTAAGG + Intronic
1193023236 X:76815283-76815305 TATTATATTTAGATTGATGAAGG - Intergenic
1193207278 X:78764109-78764131 TTTTATGTATTTATTGAGAATGG - Intergenic
1193636093 X:83950522-83950544 TTTTGTGTTTATATTCATTAGGG - Intergenic
1193837319 X:86359877-86359899 TTTTATTTTTATTTTGAGACAGG + Intronic
1193896039 X:87116151-87116173 ATTTATGTTTACATTTAGGTCGG - Intergenic
1194110058 X:89823028-89823050 TTTTATGTCTATGTTTATGAGGG + Intergenic
1194178933 X:90689083-90689105 ATTTAGGTTTATCTGGAGGAAGG - Intergenic
1194184730 X:90761583-90761605 TTTTCTTTTTATTTTGAAGAAGG - Intergenic
1194646031 X:96459473-96459495 TTTTCTGTTGATATTAAGGTTGG + Intergenic
1194877225 X:99204121-99204143 TTTTAAGTTTTTATTGTGAAGGG + Intergenic
1194994891 X:100581107-100581129 TTTTATGTATATATAGAAGGGGG - Intergenic
1195597492 X:106709340-106709362 TTTTATGTATTTATAGAGTAAGG - Intronic
1195973772 X:110502514-110502536 TATAATGTTAAAATTGAGGAAGG + Intergenic
1196004770 X:110823877-110823899 TTATATTTTTATCTTCAGGAGGG - Intergenic
1196196748 X:112844691-112844713 TTTTATGTTTATATCCTTGAAGG - Intergenic
1196243770 X:113374105-113374127 TTTTATGTTTAATATGAGGTAGG + Intergenic
1196335366 X:114525799-114525821 TTTTTTTTTTAAATTGAGGCAGG - Intergenic
1196455716 X:115890167-115890189 TTTTAAATTTATAGTGATGAAGG - Intergenic
1197485689 X:127048139-127048161 TGTTATATTTATATTTATGAAGG + Intergenic
1197729907 X:129800805-129800827 TTTTATATTTTTATTGGAGACGG - Intergenic
1197740165 X:129885288-129885310 TTTTTTATTTATTTTGAGGCAGG - Intergenic
1197965626 X:132057560-132057582 TTTTATGTATATGTGGAGGGAGG + Intergenic
1198002557 X:132453919-132453941 TTTTATATTTTTAGTGAAGACGG - Intronic
1198003276 X:132463163-132463185 TTGAATATTTATATTGAGGCGGG + Intronic
1198050631 X:132949816-132949838 TTTTATGCTTAGATTTGGGAGGG + Intronic
1198427910 X:136538254-136538276 TTTAATGTTTTTGTGGAGGAAGG - Intronic
1198468448 X:136924274-136924296 TTTTATTTTTATATTTGAGATGG + Intergenic
1198728120 X:139698142-139698164 TTTTATTTTTATTTTGAGACAGG - Intronic
1198924973 X:141779657-141779679 TTTTTTATATATACTGAGGAAGG + Intergenic
1199340761 X:146674769-146674791 TTTCATGTTTATTTTGGGGTTGG + Intergenic
1199921776 X:152413385-152413407 TTTTGTGTTTATATTCATGAAGG - Intronic
1200462719 Y:3477764-3477786 TTTTATGTCTATGTTTATGAGGG + Intergenic
1200496469 Y:3889916-3889938 TTTTTTTTTTACATTGATGATGG + Intergenic
1200531334 Y:4343590-4343612 TTTTCTTTTTATTTTGAAGAAGG - Intergenic
1200978093 Y:9234946-9234968 TGTTATATTTTTATTGTGGATGG + Intergenic
1201564272 Y:15349062-15349084 TTTTTGGTTTATTTTGAGCAGGG - Intergenic
1202172954 Y:22070538-22070560 TTTTATTTTTATTTTGAGACAGG - Intergenic
1202218406 Y:22515833-22515855 TTTTATTTTTATTTTGAGACAGG + Intergenic
1202324779 Y:23680222-23680244 TTTTATTTTTATTTTGAGACAGG - Intergenic
1202545992 Y:25989832-25989854 TTTTATTTTTATTTTGAGACAGG + Intergenic
1202589155 Y:26464459-26464481 TTTTATATTTTTATTAGGGATGG + Intergenic