ID: 1040072084

View in Genome Browser
Species Human (GRCh38)
Location 8:43196568-43196590
Sequence TGCAGGGAATGCAGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040072084_1040072089 -3 Left 1040072084 8:43196568-43196590 CCTGGGCTTCTGCATTCCCTGCA 0: 1
1: 0
2: 7
3: 46
4: 376
Right 1040072089 8:43196588-43196610 GCAGCAGTGGAGATGTGGTGTGG 0: 1
1: 0
2: 6
3: 47
4: 469
1040072084_1040072086 -8 Left 1040072084 8:43196568-43196590 CCTGGGCTTCTGCATTCCCTGCA 0: 1
1: 0
2: 7
3: 46
4: 376
Right 1040072086 8:43196583-43196605 TCCCTGCAGCAGTGGAGATGTGG 0: 1
1: 0
2: 4
3: 36
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040072084 Original CRISPR TGCAGGGAATGCAGAAGCCC AGG (reversed) Intronic
900315576 1:2054588-2054610 TGCAGCCACGGCAGAAGCCCCGG - Intronic
900555314 1:3277389-3277411 TGCAGGGAACCCCCAAGCCCAGG + Intronic
900922812 1:5684435-5684457 TGTTGGGAAGGCAGAAGCTCAGG + Intergenic
901071260 1:6519934-6519956 TGCTGGGATTGCAGAGGCCGGGG - Intronic
901672696 1:10865676-10865698 CGCGGGAAAGGCAGAAGCCCAGG + Intergenic
901919555 1:12526344-12526366 TGCTGGGATTCCAGGAGCCCGGG - Intergenic
902804140 1:18850419-18850441 GGCAGGGAAGGGAGAAGGCCAGG - Intronic
902858486 1:19226932-19226954 TGAAAGGATTGCATAAGCCCAGG + Intronic
903071783 1:20730400-20730422 GGGAGGGACTGCAGCAGCCCTGG - Intronic
904199897 1:28812703-28812725 TGCAGGAAATGCGGAGGCGCGGG - Intronic
904377280 1:30089905-30089927 TGGAGGGACTACAGAAGCCCTGG + Intergenic
904746819 1:32716552-32716574 TGCTGGGAATGGGGAAGCCTGGG - Intergenic
905711636 1:40109592-40109614 TGCAGCTACTGAAGAAGCCCAGG + Intergenic
906495972 1:46304017-46304039 TTCACAGAATGCAGAAGCCGAGG - Intronic
906838145 1:49106476-49106498 TCCAAGGAATGCAGAATCACTGG - Intronic
907278700 1:53330977-53330999 CCCAGGGACTGCAGGAGCCCGGG - Intergenic
907335374 1:53696051-53696073 TGCTGGGAGTGGAGAAGCCCTGG - Intronic
908020575 1:59894002-59894024 TGCATAGAAAGCAGAAGTCCAGG + Intronic
908714198 1:67053397-67053419 TGCAGGGGACACTGAAGCCCCGG + Intronic
909289762 1:73867560-73867582 TGCAGAGAATGCATAGTCCCTGG - Intergenic
909616346 1:77613708-77613730 GGCAGGGAATGGAGAAGGTCAGG - Intronic
910159352 1:84256807-84256829 TGGTGGGAAAGCAGAAGCCAGGG + Intergenic
912643437 1:111369137-111369159 CTCAGAGAATGCAGAAGCCCTGG + Intergenic
912694717 1:111832582-111832604 TGCAGGGAAAGCTGAGCCCCTGG + Intronic
913090183 1:115471505-115471527 TCAAGGGAGTGCAGAAGCCTTGG - Intergenic
913317987 1:117568307-117568329 TGCAGAGAAGGCAGAAAACCTGG + Intergenic
914696102 1:150081613-150081635 TGAAGGGAAGGCAGAAGACTTGG + Intronic
916206350 1:162319503-162319525 TGCAGGGCATACAGAAGGACTGG - Intronic
916497218 1:165356642-165356664 AGGAGGGAAGGCAGAGGCCCAGG + Exonic
916600994 1:166293405-166293427 TGCAGGTGAAGGAGAAGCCCTGG - Intergenic
918497134 1:185153425-185153447 TCAAGGTAATGCAGAAGCCAAGG + Intronic
919544843 1:198902812-198902834 AGAAGGGACTGCAGAAGCCAAGG + Intergenic
919767501 1:201136697-201136719 TGCAGGAAATGCAGAGGCTCCGG - Intronic
919883678 1:201917338-201917360 TGCAGTGAATGCAGAAGCCTTGG - Intronic
919928911 1:202208680-202208702 TACTCTGAATGCAGAAGCCCAGG + Intronic
919929139 1:202209757-202209779 TGTGAGGAATGCAGAAGCTCAGG + Intronic
920033928 1:203053625-203053647 TGCTGGAAATGCAGAATCTCAGG - Intronic
920213054 1:204342590-204342612 TGCTGGAAATGCAGAATCTCAGG - Intronic
920500169 1:206480630-206480652 GGCAGGGAAGGCAGTAGCCCTGG - Intronic
921985138 1:221304652-221304674 AGGAGGGAATGCAGAAGACTGGG - Intergenic
922744528 1:228036811-228036833 TGCAGTGGATGCAGCAGCCCAGG + Intronic
923239222 1:232064198-232064220 GGCAGGGGAAGCAGTAGCCCAGG - Intergenic
1062901405 10:1149447-1149469 AGCATGAGATGCAGAAGCCCAGG - Intergenic
1064399231 10:15007194-15007216 TGCAGGGAAATCAGAATCTCAGG + Intergenic
1064727641 10:18297663-18297685 AGCAGGGAGTGGAGCAGCCCTGG - Intronic
1064742000 10:18443403-18443425 TGCAGGGCCAGCAGGAGCCCAGG + Intronic
1065859561 10:29860337-29860359 TGCAGGGCATACAGCAGCCTTGG - Intergenic
1066231505 10:33439295-33439317 TGGGAGGAATGCTGAAGCCCAGG - Intergenic
1067657609 10:48208587-48208609 TACAGGGAATCCAAAAGGCCTGG + Intronic
1067841980 10:49688423-49688445 TGCAGGGAAGTCAGGAGGCCAGG - Intronic
1068303599 10:55176572-55176594 TGCAGGGTTTGAAGATGCCCTGG - Intronic
1068444116 10:57098021-57098043 TGCAGGGAATTCACAAGCTCAGG - Intergenic
1068517679 10:58044503-58044525 GGAAGGGAAGGCAGAAGCCCTGG - Intergenic
1069209457 10:65737966-65737988 AGCAGGGACTGGATAAGCCCAGG + Intergenic
1070090996 10:73285582-73285604 TCTAGGAAATGCAGAAACCCAGG + Intronic
1070401196 10:76055182-76055204 TGGAGGGAAGGCAGAACCCAGGG + Intronic
1071103460 10:82066483-82066505 TGCAGGGAAGGCAGAGGCAAGGG + Intronic
1071498951 10:86190077-86190099 TGAAGGGAAGGCAGGAGCCTGGG - Intronic
1071532231 10:86399396-86399418 TGCAGGAAATGCAGAAAACAGGG + Intergenic
1072158389 10:92744296-92744318 TGAAGGGAAAGCAGCAGCCCAGG - Intergenic
1072203468 10:93181385-93181407 TGCAGGGACTCCAGAGCCCCAGG - Intergenic
1072801109 10:98393029-98393051 TGGAGGGAATGCAGGGGGCCTGG - Exonic
1073103498 10:101019219-101019241 TGCAGGGAGTAGAGAAGCCAGGG + Intronic
1073324180 10:102632983-102633005 GGCAGGGACTGGAGAAGCCAAGG + Exonic
1074047292 10:109850587-109850609 GGAAGGTAATTCAGAAGCCCAGG + Intergenic
1074062112 10:109976020-109976042 TGAAAGGAATTCAGAATCCCAGG + Intergenic
1074472446 10:113739810-113739832 AGCAGTGAATGCAAAGGCCCTGG + Intergenic
1076227738 10:128793864-128793886 AGCAAGGAATGGTGAAGCCCTGG + Intergenic
1076345300 10:129775136-129775158 TTCAGTGCATGCAGGAGCCCAGG - Intergenic
1076434802 10:130432975-130432997 TGCAGGCACTGCAGATGTCCTGG + Intergenic
1077149984 11:1068250-1068272 AGCAGGGAATGAATGAGCCCAGG + Intergenic
1077577149 11:3392962-3392984 TGCAGGGAAAGCAGAACTTCAGG + Intergenic
1078183558 11:9032208-9032230 TGCAGGGACAGCTTAAGCCCAGG - Intronic
1078334245 11:10451135-10451157 AGCAGGGAAGGCGGAAGCCGCGG - Intronic
1079152951 11:17917771-17917793 TGCTGGAAATGCAGAATCTCAGG + Intronic
1079160633 11:17990065-17990087 TGCAGTGAAAGCAGAAGACCTGG - Intronic
1079261609 11:18887737-18887759 TACTGTGCATGCAGAAGCCCAGG + Intergenic
1079353692 11:19713667-19713689 TGCTGGGAAAGCCCAAGCCCCGG + Exonic
1079603748 11:22341675-22341697 CGAAGGAGATGCAGAAGCCCAGG - Exonic
1080223048 11:29928744-29928766 ATCAGCAAATGCAGAAGCCCTGG - Intergenic
1080701104 11:34644813-34644835 TGCTAGGAATGCAGAAACTCAGG + Intronic
1081255968 11:40895511-40895533 TCCCTGGAATTCAGAAGCCCTGG - Intronic
1081355142 11:42103394-42103416 TGCAGGGAATGCAATGTCCCAGG + Intergenic
1081702760 11:45162270-45162292 GGCAGGGGTTGCAGCAGCCCTGG + Intronic
1081744261 11:45462033-45462055 TGCTGTGAATGCAGCAGCCCTGG + Intergenic
1081758342 11:45560251-45560273 TGCAGGGAAAGCAGAGTCCTTGG - Intergenic
1082059424 11:47847942-47847964 TGCAGGGACTGCAAATGCCGTGG - Exonic
1082188850 11:49217130-49217152 AGCAGAGGATGCAGAGGCCCTGG + Intergenic
1083714606 11:64568271-64568293 TGTGGGGATGGCAGAAGCCCTGG - Intronic
1083896186 11:65620923-65620945 TGCAGGGCATGCAGGTGCGCCGG + Exonic
1084290149 11:68159310-68159332 TGTAGGGAATGCAGGTGCGCTGG - Intronic
1084779716 11:71400196-71400218 TGACGGGAATGCAGAAACACGGG - Intergenic
1084803474 11:71562858-71562880 TGCAGTGAATCCTGTAGCCCTGG - Intronic
1084846194 11:71901951-71901973 TGCAGGGAAAGCAGAACTTCAGG - Intronic
1085263294 11:75220998-75221020 TGCAGGCAAGGCAGATGCCTTGG - Intergenic
1088646842 11:111924267-111924289 TGGAGGGAAGGCAGAGGCCAGGG + Intronic
1088707855 11:112479969-112479991 TTCTAGAAATGCAGAAGCCCAGG - Intergenic
1090076211 11:123581476-123581498 TTCCGGGAATGCAGAACCACGGG + Intronic
1090466877 11:126942817-126942839 TGCATGGAAAGCAGAAATCCTGG - Intronic
1091223370 11:133944004-133944026 TGCAGGCAGTGCAGGTGCCCAGG - Intronic
1091395851 12:153894-153916 TGCAGAGAATGCTGATTCCCAGG + Intronic
1091449686 12:564811-564833 TGCTGGAAATGCAGAATCTCAGG - Intronic
1091455831 12:607153-607175 TGCTGGAAATGCAGAACCTCAGG + Intronic
1091804825 12:3348280-3348302 TGCTGGGATGGCAGAGGCCCAGG - Intergenic
1092433749 12:8429816-8429838 TGCAGGGAAAGCAGAACTTCAGG + Intergenic
1094805055 12:34082726-34082748 TGGAAGGAATGCAGGAGCCCAGG + Intergenic
1095102989 12:38202456-38202478 TTCAGGGAAGGCAGTAGCCACGG - Intergenic
1095419135 12:42007067-42007089 TGCAGTGAATGAAGCATCCCTGG - Intergenic
1095516534 12:43012406-43012428 TGTTGGAAATGCAGAATCCCAGG - Intergenic
1095834961 12:46627923-46627945 TGCAGGGAAGGCAAAAGACAAGG - Intergenic
1095959860 12:47827517-47827539 TGCAGGGAACCCTGGAGCCCAGG - Intronic
1096181257 12:49551779-49551801 TGTGGGGACTGCTGAAGCCCTGG + Intronic
1096496714 12:52043062-52043084 TGGAGGGAAGGGGGAAGCCCTGG + Intronic
1098148866 12:67525929-67525951 TACAGGGAAACCAAAAGCCCAGG - Intergenic
1099393467 12:82108612-82108634 TGCTGAGAATTCAGTAGCCCTGG - Intergenic
1100435866 12:94570998-94571020 TTCAGGGAATGAAGAATCACAGG - Exonic
1100494450 12:95111446-95111468 TTCATTGAAGGCAGAAGCCCAGG + Intronic
1100584963 12:95971024-95971046 TGCTAGGAATGCAGAACCTCTGG + Intergenic
1101213899 12:102561957-102561979 TGCAGGGAAGGTAGAAGCACAGG - Intergenic
1101589255 12:106111634-106111656 TGCTGGAAATGCAGAATCCCAGG - Intronic
1102084239 12:110123194-110123216 TGCTGGAAATGCAGAAGGGCAGG - Intergenic
1102258299 12:111428716-111428738 TGCAGGGGAGGCAGAGGCACAGG + Intronic
1102627285 12:114245178-114245200 TTCAGGGGATGCAGATGCCAGGG - Intergenic
1103213469 12:119183429-119183451 TCCAGGGAAGGCAGAGTCCCTGG - Intronic
1103221451 12:119249387-119249409 ACCAGGGAATGCAGAACCCCTGG + Intergenic
1103858131 12:123989040-123989062 GTCTGGGAAGGCAGAAGCCCAGG - Intronic
1104045523 12:125160037-125160059 GGCTGTGAATGCAGAAGGCCTGG + Intergenic
1104120267 12:125791821-125791843 TTAAAGGAAGGCAGAAGCCCTGG + Intergenic
1104171227 12:126283077-126283099 AGCAGAGGATGCAGAAGCACAGG + Intergenic
1104499601 12:129272219-129272241 TGCTGGGAATGCAGGATCCTAGG + Intronic
1104738479 12:131154656-131154678 TGTAAGAAATGCAGAATCCCAGG - Intergenic
1111905917 13:94255951-94255973 TACAGGAAATGCAGAATCACAGG + Intronic
1112212966 13:97399569-97399591 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1113910165 13:113837919-113837941 TGCAGAGACTACACAAGCCCAGG - Intronic
1113936651 13:113998443-113998465 TGCAGGGAAGGCACAGTCCCTGG - Intronic
1114691119 14:24582554-24582576 AACAGGCAATGCACAAGCCCTGG + Intergenic
1114733366 14:25018219-25018241 TGCAGGCAAGTCAGAAGCCACGG - Intronic
1115087164 14:29531548-29531570 TGAAGCCAATGCAGAAGCTCTGG - Intergenic
1115418264 14:33162021-33162043 TGCCAGGAATGAAGAAGCCTAGG - Intronic
1117478632 14:56120424-56120446 TGCAGGGCATTCCGAAGCCACGG + Intronic
1117914641 14:60664343-60664365 TGCAAGAAATGGAGAAGCTCTGG + Intergenic
1119140329 14:72261545-72261567 TGCAGGGAATGGAGATCCACTGG + Intronic
1119953736 14:78772697-78772719 TGCTAGAAATGCAGAATCCCAGG - Intronic
1121115730 14:91341431-91341453 CCCAGGGAATTCTGAAGCCCAGG + Intronic
1121219925 14:92277625-92277647 TGCTGGAAATGCAGATTCCCAGG + Intergenic
1121235689 14:92389877-92389899 GGCAGGGAACGCAGGCGCCCAGG - Intronic
1121469269 14:94139273-94139295 TGCTGGCAATGCAGAATCTCAGG - Intergenic
1122429001 14:101628173-101628195 TGAGGGAATTGCAGAAGCCCCGG + Intergenic
1122957974 14:105080660-105080682 TGGAAGGATTGCTGAAGCCCAGG - Intergenic
1125725454 15:41866149-41866171 TGCAGGGCCTGCGGAAGCACTGG - Exonic
1127329170 15:57922138-57922160 TGAAGGGAATGCTGAAGCTTGGG - Intergenic
1127464943 15:59234728-59234750 GGAAGGGAATGCATAAGCCCAGG + Intronic
1128063340 15:64748804-64748826 TGCAGGGAAGCTGGAAGCCCTGG + Intronic
1128307559 15:66609956-66609978 TGCTGGAAATGCAGAATCTCAGG - Intronic
1129706851 15:77799302-77799324 GCCAGGGACTGCAGGAGCCCAGG + Intronic
1129798083 15:78393130-78393152 GACAGGGAGTGCAAAAGCCCTGG - Intergenic
1131294739 15:91136998-91137020 TGCAGGCAAAGCAAAAGCACTGG + Intronic
1134488773 16:14679890-14679912 TGCTGGGAATGCAGAAGAGTGGG - Intronic
1135799696 16:25481271-25481293 AGCAGGGAATACAGAAACCAAGG - Intergenic
1136351446 16:29711110-29711132 TGCTGGGAATCCAGAAACCACGG + Intergenic
1136579742 16:31143961-31143983 CGCAGGGAATGCAGAGGACAAGG - Intronic
1136776992 16:32877305-32877327 AGCAGGGAAGGCAGCAGCCCAGG - Intergenic
1136893624 16:33984208-33984230 AGCAGGGAAGGCAGCAGCCCAGG + Intergenic
1137290508 16:47049178-47049200 TGCAGGGATTGCGGCAGCCAGGG + Intergenic
1137636745 16:49993219-49993241 TGCAGGGGCTGCAGAAGTCAAGG + Intergenic
1138332620 16:56227233-56227255 AGCAGGGAATGGAGGAGGCCAGG - Intronic
1139432827 16:66920268-66920290 TTCAAGGAATGCAGAAGGCATGG - Intergenic
1140035085 16:71365630-71365652 TGTTAGGAATGCAGAATCCCAGG - Intronic
1141752508 16:85968295-85968317 GGCTGGAAATGCAGAATCCCGGG - Intergenic
1203079409 16_KI270728v1_random:1139414-1139436 AGCAGGGAAGGCAGCAGCCCAGG - Intergenic
1142806302 17:2372833-2372855 TGTAGTGACTGCTGAAGCCCAGG - Intronic
1142849568 17:2697835-2697857 TGCAGGGAGTGCGGGCGCCCTGG - Intronic
1143282094 17:5762554-5762576 AGCAGGGACTCCAGCAGCCCTGG + Intergenic
1144357406 17:14459378-14459400 TGCTGGAAATGCAGAATCTCAGG - Intergenic
1145800091 17:27677102-27677124 TGCAGGGCAGGAAGCAGCCCAGG + Intergenic
1146650358 17:34602609-34602631 TGCAGGGGATGCTGAAGCTCTGG - Intronic
1146686074 17:34842362-34842384 TGCAGGGGAGTCAGAAGACCTGG + Intergenic
1148216151 17:45834980-45835002 GGCAGGGAAGCCAGAGGCCCTGG - Exonic
1148370312 17:47094812-47094834 TGCAGGGACTGCTTGAGCCCAGG + Intergenic
1148559945 17:48600253-48600275 GGCAGGGAAGGCTGAGGCCCAGG - Intronic
1148794925 17:50192418-50192440 TGCAGGGAATCCAGAGGGACAGG - Intronic
1148969542 17:51467813-51467835 AGCAGGGACTGGAGGAGCCCAGG - Intergenic
1149396457 17:56249901-56249923 AGCAGAAAATCCAGAAGCCCTGG - Intronic
1149590764 17:57828207-57828229 TGGAGGGATTGCTTAAGCCCAGG + Intergenic
1150128040 17:62651424-62651446 TCCAGGGCATGGAGAAGCCAGGG + Intronic
1150653631 17:67025503-67025525 TGCAGAGGAAGCAGAAGTCCAGG + Intronic
1151546274 17:74795219-74795241 TCTAGGGAATGCAGATGCCCAGG + Intronic
1151667391 17:75553159-75553181 TGCAGAGCCTGGAGAAGCCCTGG - Intronic
1151871595 17:76840476-76840498 AGCAGCAAATGCAGGAGCCCTGG - Intergenic
1151960807 17:77404705-77404727 TGTAGGAAATGCAGAGTCCCAGG - Intronic
1152327537 17:79650394-79650416 CTCAGGGAAAGCAGAGGCCCTGG + Intergenic
1153523510 18:5974301-5974323 TGCAGGGTCTGAAGAGGCCCTGG + Intronic
1153660712 18:7323456-7323478 TTCAGGGAATGCACATTCCCAGG + Intergenic
1153986389 18:10354558-10354580 TGAAGGAAATGCAGAAAGCCTGG - Intergenic
1154193491 18:12249363-12249385 TGCCGGAAGTGCAGATGCCCAGG + Intergenic
1156386018 18:36606059-36606081 TTCAGGGAAAGCAGGACCCCAGG + Intronic
1156403513 18:36761427-36761449 TGCAGGCAGTGAAGAAACCCAGG - Intronic
1157167624 18:45372651-45372673 TGTTGGGAATGCAGAATCTCAGG - Intronic
1157168849 18:45383823-45383845 TGGAGGAAATAAAGAAGCCCAGG - Intronic
1157180004 18:45488645-45488667 TGCAGGAAATGAAGATGCTCTGG + Intronic
1157579378 18:48764571-48764593 TGCAGGGACAGCTGAAGTCCAGG + Intronic
1159948104 18:74458262-74458284 TTCAGTGAATGCAGGAGCCCCGG - Intergenic
1159972461 18:74670891-74670913 TGAAAGGAATGCTTAAGCCCAGG - Intronic
1160321485 18:77900223-77900245 TGCAGGAGCTGCAGGAGCCCCGG + Intergenic
1160672312 19:371620-371642 AGAAGGGAATGGAGAAGGCCTGG - Intronic
1161736411 19:5994826-5994848 TGCAGGGCATCTAGCAGCCCCGG - Exonic
1162545228 19:11325157-11325179 TGCATGGCAGGCAGAGGCCCAGG - Exonic
1162792527 19:13070411-13070433 AGCAGGGAAGGCTGAAGCCAGGG - Intronic
1163031181 19:14545299-14545321 GGCGGGGAATGCAAAGGCCCTGG - Intronic
1163345272 19:16737354-16737376 GGCAGGGAGATCAGAAGCCCAGG - Intronic
1163471566 19:17500376-17500398 GGCAGGGGATGCAGAGGCCCTGG - Exonic
1163485051 19:17580539-17580561 TGGAGTGAATGCAGGAGCCCAGG - Intronic
1164155385 19:22593116-22593138 TGTAAGGAATGCAGAATCTCAGG + Intergenic
1166647493 19:44543017-44543039 TGCAGAGAATTGAGAAGACCAGG + Intergenic
1167119830 19:47510160-47510182 TGCAGAGCGTGCAGAAACCCCGG - Intronic
1167211316 19:48135860-48135882 GGCAAGGAATGCAGATGCCGCGG + Intronic
1167557440 19:50205188-50205210 AGCAGGGAAAGCTGAGGCCCAGG + Intronic
1167609019 19:50497301-50497323 AGCAGGGACCGCAGAGGCCCCGG + Intergenic
1167739920 19:51318400-51318422 TGCAGGGAAGGCAGGACTCCGGG - Intronic
1168381080 19:55923962-55923984 TTCAGGGAATGTACAGGCCCAGG - Exonic
925214965 2:2086624-2086646 AGCAGGGCAGGCAGAAGCCAGGG - Intronic
925506573 2:4572366-4572388 TGGAGGGAAGACACAAGCCCAGG - Intergenic
926210107 2:10863075-10863097 AGCCGGGAATGCAGAGGCCCAGG - Intergenic
926233761 2:11024064-11024086 TTCAGGGACTGCAGCATCCCAGG - Intergenic
926691894 2:15742147-15742169 TGCACGGGATGCAGAACCCATGG + Intronic
927056144 2:19367273-19367295 TGCTGGAAATGCAGAAGCCCAGG + Intergenic
927501991 2:23589190-23589212 TGCAGGCAAGGCACAAGCCCAGG - Intronic
928964814 2:36966294-36966316 TGCAGGAAGTGCAGGATCCCCGG + Exonic
929451681 2:42042312-42042334 GGCAGGGACTACAGAGGCCCAGG + Intergenic
930053510 2:47235014-47235036 TGCAGGGACTGCATCAGCACAGG - Intergenic
931484198 2:62673775-62673797 TGGAGGGAAGTCAGAAGACCTGG - Intergenic
932350871 2:71030538-71030560 TGCAGGGAAATCAGAATCTCAGG - Intergenic
932409190 2:71535150-71535172 TGCTGGGGAGGCAGGAGCCCTGG - Intronic
934780156 2:96964857-96964879 TGCAGGGAAGCCAGATGCCTGGG - Intronic
935636973 2:105256431-105256453 TGCGGGTAAGCCAGAAGCCCAGG - Intergenic
937237822 2:120441481-120441503 TGCTGGGACTGCGGGAGCCCCGG + Intergenic
937834611 2:126459701-126459723 TGCAGGGAATGCAGTGTCCTTGG + Intergenic
937854669 2:126663682-126663704 TGCAGTGAATGCTGGGGCCCAGG - Intronic
937973872 2:127569414-127569436 GGCTCGGAATGCAGATGCCCAGG - Intronic
938375178 2:130800164-130800186 TGCACTGAATGCTGCAGCCCTGG + Intergenic
938919755 2:135985062-135985084 TGCACGTAATGCACAATCCCTGG - Intronic
940704643 2:157088519-157088541 TGTATGGTATGCAGAAACCCTGG + Intergenic
941321099 2:164055710-164055732 TGCAGCAAATGCAGAAACCCTGG + Intergenic
943185037 2:184597591-184597613 TCCAGGGAATGCTGCAGACCCGG + Intergenic
944510174 2:200456703-200456725 TGCAGGCAAAGCAGAGGTCCTGG - Intronic
946203044 2:218082368-218082390 TGGAGGGAAGGCAGACGCCTGGG - Intronic
946643392 2:221807872-221807894 TGCAGGAAATGCAGAATCTTGGG + Intergenic
947524997 2:230872304-230872326 TGGAGATAATGCAAAAGCCCCGG - Intronic
947708999 2:232299482-232299504 CACAGTGAGTGCAGAAGCCCTGG - Intronic
947827337 2:233115280-233115302 TGCAGGCAGAGCAGGAGCCCCGG - Intronic
948258705 2:236587066-236587088 GGCAGGAAATGGAGAAGCCATGG - Intergenic
948275492 2:236705044-236705066 GGCAGAGAATGCAGAATGCCTGG - Intergenic
948456249 2:238105936-238105958 TGCAGTGCATGCAAAGGCCCCGG - Intronic
1168849562 20:967261-967283 TGCACCGGATGCAGAAGTCCTGG + Exonic
1169068853 20:2709533-2709555 AGGAGGGAAGGCAGAAGCCAAGG - Intronic
1169555951 20:6750188-6750210 TGCAGGGGATGCTTGAGCCCAGG + Intergenic
1169902963 20:10571455-10571477 AGCAGTGTGTGCAGAAGCCCAGG - Intronic
1170012803 20:11745624-11745646 TGCAGGGAATTCAAAAGTGCAGG + Intergenic
1170148630 20:13205032-13205054 TCCAGAAAATGCAGAAGCCAAGG - Intergenic
1170592958 20:17785097-17785119 AGCAGGAAACACAGAAGCCCAGG - Intergenic
1171038998 20:21742599-21742621 TGCATGAGATGCTGAAGCCCTGG + Intergenic
1171376019 20:24694527-24694549 TGCAGGTGATGGAGAAGCTCAGG - Intergenic
1171881757 20:30622415-30622437 TGCCTGGAATGCACAAGCCTCGG - Intergenic
1172068541 20:32239151-32239173 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1172553533 20:35820920-35820942 GGCAGCCAAGGCAGAAGCCCTGG + Intronic
1172783488 20:37451021-37451043 TGCAGGGACCTCTGAAGCCCTGG - Intergenic
1173150373 20:40561992-40562014 TTCAGGGAAGGCAGTGGCCCAGG - Intergenic
1174853666 20:54021865-54021887 TGCAGGATGTGCAGGAGCCCGGG - Intronic
1175160029 20:57001524-57001546 TGCTAGAAATGCAGAGGCCCAGG + Intergenic
1175367499 20:58466317-58466339 TGCTGGAAATGCAGAACCCCGGG + Intronic
1175416795 20:58806651-58806673 TTCAGGGAATCCAAAAGGCCTGG + Intergenic
1175922636 20:62457287-62457309 CGCAGGGATTCCAGAAGCGCCGG - Intergenic
1176905355 21:14493876-14493898 TGCTGGGATTGCAGAACCCCAGG + Intronic
1178832820 21:36070514-36070536 TGCAGGGAGTGCAGAAACCTTGG + Intronic
1178937285 21:36874716-36874738 TCCATGGAGTGCAGCAGCCCTGG - Intronic
1179100452 21:38351492-38351514 TGCTGGAAATGCTGAAGCTCAGG + Intergenic
1179455369 21:41495839-41495861 TTCAGCAGATGCAGAAGCCCTGG - Intronic
1179674348 21:42971932-42971954 TCCAGGGCAGACAGAAGCCCAGG - Intergenic
1179730066 21:43362658-43362680 TGCGTGGAGTGCAGAAGGCCTGG - Intergenic
1181527314 22:23497409-23497431 TGCTGGGACTGCAAGAGCCCCGG - Intergenic
1181674782 22:24444598-24444620 TGCAGGGCTTGGAGCAGCCCAGG - Intergenic
1182016302 22:27042771-27042793 TCCAGGAAATGCGGAAGCTCAGG - Intergenic
1182087524 22:27571573-27571595 TGGTGAGAATGCAGATGCCCAGG - Intergenic
1182431503 22:30301663-30301685 AGGAGGGAGTACAGAAGCCCTGG + Intronic
1185225389 22:49648867-49648889 GGCAGGAAATGCAGACTCCCGGG - Intronic
949885476 3:8689802-8689824 TGCAGGGAAATCAGAATCTCAGG - Intronic
950984646 3:17348416-17348438 TGGTGGAAATGCAGAACCCCAGG - Intronic
951049593 3:18079151-18079173 TACGGGGAATGCAGATTCCCAGG - Intronic
951471695 3:23063465-23063487 TGCAGGAAATGCAGAATCTCAGG + Intergenic
952925835 3:38318601-38318623 TGTGGAGAATGCAGAGGCCCTGG + Intergenic
953366311 3:42348442-42348464 TGCAGGGAAACCAGCAGCCAAGG + Intergenic
953688602 3:45098053-45098075 AGCAGGGACTGCAGAAGCAGAGG - Intronic
953831161 3:46298592-46298614 TGCTAGGAATGCAGAATCTCAGG + Intergenic
954437761 3:50504923-50504945 TGCTGGGATTGGAGAAGCCAAGG - Intergenic
955648502 3:61166979-61167001 TTCAGGGGCTGGAGAAGCCCAGG + Intronic
955807761 3:62755177-62755199 TGCAGGGAAGGAAGGAACCCGGG - Intronic
957045676 3:75372573-75372595 TGCAGGGAAAGCAGAACTTCAGG + Intergenic
960129068 3:114033990-114034012 TGCAGGAACTGCAAAAGCCTTGG - Intronic
960663423 3:120086438-120086460 TGTAGTTTATGCAGAAGCCCAGG + Intronic
961273145 3:125704985-125705007 TGCAGGGAAATCAGAATCTCAGG - Intergenic
961276709 3:125733054-125733076 TGCAGGGAAAGCAGAACTTCAGG - Intergenic
961385779 3:126522573-126522595 GGCAGGGAATGCAGATGACCTGG + Intergenic
961877720 3:130036704-130036726 TGCAGGGAAAGCAGAACTTCAGG + Intergenic
962708979 3:138069943-138069965 TCCAGAGAAGGCAGAACCCCAGG + Intronic
966023975 3:175252506-175252528 TTCAGGGAATACAGAGGCCCAGG - Intronic
968913144 4:3485815-3485837 AGCAGGGCTTGCAGAAGCCCAGG - Intronic
969787195 4:9467789-9467811 TGCAGGGAAAGCAGAACTTCAGG - Intergenic
973170731 4:47139810-47139832 TGTTGGAAATGCAGAAGCTCAGG - Intronic
977213776 4:94253650-94253672 TGAAGGGAAGGCATAAGCACTGG + Intronic
977823738 4:101505672-101505694 TGCAGAATATCCAGAAGCCCAGG + Intronic
978245314 4:106564837-106564859 TGCAGAAAATGCAAAAGCCTAGG + Intergenic
981380429 4:144065262-144065284 TGCAGTTAATGCAGAAGTGCAGG - Intergenic
982307052 4:153943647-153943669 TGTGGGGAGTTCAGAAGCCCAGG + Intergenic
982719032 4:158840208-158840230 TACAGGGAAAGCAGGAGGCCAGG + Intronic
983338298 4:166423784-166423806 TTCAAGGAATGCAAAAGCCAAGG - Intergenic
985096802 4:186420922-186420944 TGCCGGGGAGGCTGAAGCCCTGG - Intergenic
987288392 5:16483805-16483827 TGCAATATATGCAGAAGCCCTGG + Intronic
987394590 5:17410271-17410293 TTCACTGAATGAAGAAGCCCAGG - Intergenic
988490361 5:31700541-31700563 TGCAGGGAATGCGGCAACCCTGG - Intronic
988993350 5:36692446-36692468 TGCAGGGAATGGACCAGCCAGGG - Intergenic
992569323 5:78038710-78038732 TGCAGGGAATGAAGCTGACCAGG + Intronic
996977688 5:129454966-129454988 TGAAGGGACTGCTTAAGCCCAGG + Intergenic
997450664 5:133980419-133980441 TGCAGGGAATGGACACGCTCTGG + Intronic
998992527 5:147833661-147833683 TGCAGGAAATGCAGAAACCCAGG - Intergenic
1002934709 6:1661797-1661819 AGCAGGGAATGCTGAAGCAAGGG - Intronic
1003028479 6:2579652-2579674 TGCAGGAAGTGCAGACTCCCGGG - Intergenic
1003996925 6:11551079-11551101 TGCAGAGAATGCAGTAGTCCTGG - Intronic
1004280551 6:14276202-14276224 TGCAGGGAATCCAGAGTGCCAGG - Intergenic
1004480776 6:16017524-16017546 TGGAGGGGATGCAGAAGCCCGGG + Intergenic
1008269009 6:49467408-49467430 TGCAGGGAATGGGGAAGGGCAGG + Intronic
1008893601 6:56525388-56525410 TGCAGTGATAGCAAAAGCCCTGG - Intronic
1011753523 6:90476557-90476579 TGCAGAGACTGCAGCAGCCTTGG + Intergenic
1012938734 6:105395497-105395519 AACAGGGAATGCAGAACTCCCGG + Intronic
1015317601 6:131834329-131834351 TGGAGGGCTTGCAGAAACCCAGG + Intronic
1015840113 6:137467846-137467868 TGCTGGGAATGCAGCATCCTGGG - Intergenic
1018192729 6:161324839-161324861 TCCAGGGGAAGCAGAAACCCAGG + Intergenic
1018397734 6:163392206-163392228 GGGAGGGAATGCGGAAGCCCAGG + Intergenic
1018416778 6:163608424-163608446 TGCAGGGACTGCCGGGGCCCAGG - Intergenic
1019019086 6:168902631-168902653 TTTTGGGAATGCAGAAGTCCAGG + Intergenic
1019484683 7:1284117-1284139 GGCAGGGTCTGCAGAAGTCCCGG + Intergenic
1019604508 7:1901773-1901795 GGCAGGGAAGGCAGGAGCCAGGG - Intronic
1019747176 7:2707467-2707489 AGCCGGGAAACCAGAAGCCCAGG - Intronic
1019756712 7:2776121-2776143 AGCAAGGATTGCTGAAGCCCAGG - Intronic
1019812727 7:3176337-3176359 TGAGAGGAATGCTGAAGCCCAGG + Intergenic
1019900724 7:4018842-4018864 TGCAGGGAATGTAGGAGGCGGGG + Intronic
1020312771 7:6881785-6881807 TGCAGGGAAAGCAGAACTTCAGG + Intergenic
1021190939 7:17619068-17619090 TACAGGGAATGCATTAACCCTGG - Intergenic
1022137620 7:27464298-27464320 TGAAGAGAATGCAGAATTCCAGG + Intergenic
1022531697 7:31070826-31070848 TGCTGGAAATGCAGATGCTCAGG - Intronic
1023056369 7:36293419-36293441 TTCAGGAAATGCTGAAGACCAGG + Intronic
1023292902 7:38686486-38686508 TGCTGGGAATCCACAAGTCCTGG + Exonic
1023767932 7:43529283-43529305 TGCAGGGAATGAAGGCGCTCAGG - Intronic
1023969044 7:44978240-44978262 TGGAGGGCAGGGAGAAGCCCGGG - Intronic
1024092454 7:45955783-45955805 AGCAGGGATAGCAGTAGCCCCGG + Intergenic
1024291382 7:47807079-47807101 GGCAGGGACAGCAGAAGCCTGGG - Intronic
1028693506 7:93681429-93681451 TGAAAAGAATTCAGAAGCCCAGG + Intronic
1029980099 7:104870686-104870708 TGCAGAGAAGAAAGAAGCCCTGG + Intronic
1032499193 7:132387209-132387231 TGCAAGAAATGCAGAATCTCAGG + Intronic
1032714448 7:134493480-134493502 TGAAGGAAATGAAGAAACCCAGG + Intergenic
1034421806 7:150994653-150994675 TGCAGGGAAGGCTGAGGGCCGGG + Intronic
1034669653 7:152848352-152848374 GGCAGGGAATGCTGCAGCCTTGG - Intronic
1034718718 7:153267600-153267622 TGCAGAGAATGCCAAGGCCCTGG - Intergenic
1034738900 7:153455170-153455192 AACAGTGAATGCAGCAGCCCAGG - Intergenic
1034923495 7:155102527-155102549 TGGAGGGGATGCAGAAGCCTTGG - Intergenic
1034948013 7:155276573-155276595 TGCTGGAAATGCAGAAGCCTGGG + Intergenic
1035086188 7:156260338-156260360 TGCAGGGAGTGCAGGGGCCCAGG - Intergenic
1035756120 8:2034243-2034265 GGAAGGGGATGCAGAAACCCAGG - Intergenic
1035901817 8:3465216-3465238 TTCAGGGGATGCACAGGCCCTGG + Intronic
1036480086 8:9131815-9131837 GACAGGGAATGCAGAGGCCCAGG - Intergenic
1036590134 8:10161664-10161686 TGGAGAGAATGCAGGAGACCCGG + Intronic
1036769700 8:11570573-11570595 ATCAGGGAAAGCAGAAGCACCGG + Intergenic
1037655609 8:20881605-20881627 TTCAGGGAATGTAAAAGCCTGGG + Intergenic
1038494370 8:27991084-27991106 TGCAGGGAACACAGAAGCCAAGG + Intronic
1039884764 8:41648608-41648630 TGGAGGGAATTCACAGGCCCTGG - Intronic
1040072084 8:43196568-43196590 TGCAGGGAATGCAGAAGCCCAGG - Intronic
1040548777 8:48422582-48422604 GGCAGGGAAGCCAGACGCCCGGG - Intergenic
1041076468 8:54174558-54174580 TGCAAGAAATGCGGCAGCCCAGG - Intergenic
1042677553 8:71338799-71338821 CGCAGGGAAGGCAGCAGCCTTGG + Intronic
1042993731 8:74669687-74669709 AGCAGGAATTGCAGATGCCCTGG - Intronic
1044957682 8:97498359-97498381 TGGAGGGAACCGAGAAGCCCAGG - Intergenic
1045216774 8:100157195-100157217 AGCAGGGAATACAGCAGTCCGGG + Intergenic
1047372190 8:124265308-124265330 TGCTGGCCATGCAGAAACCCGGG - Intergenic
1047611303 8:126523460-126523482 GGCAGGGAATGCAGGAGCCCAGG + Intergenic
1047676139 8:127205373-127205395 AGCAGGGAATGCAGCAGCAGAGG + Intergenic
1048629754 8:136229323-136229345 TTCAGGGAAGGATGAAGCCCAGG - Intergenic
1049651026 8:143769866-143769888 TGCAGGGAAAACAGTAGGCCAGG - Intergenic
1049720508 8:144113403-144113425 AGCAGGGAATGCTGAGGACCTGG - Intronic
1049770652 8:144379418-144379440 TGCACAGCAGGCAGAAGCCCTGG + Exonic
1050460829 9:5875983-5876005 GGCAGGGGGAGCAGAAGCCCTGG + Intergenic
1052746766 9:32448985-32449007 TGGTGAGAATGCAGATGCCCTGG + Exonic
1056114264 9:83426570-83426592 TGCTGGAAATGCAGAATCTCAGG + Intronic
1057126251 9:92618348-92618370 TGCGGGGAAAGCTGAAGGCCCGG - Exonic
1057389822 9:94633617-94633639 TGCAGGGGAAGCAAAAGGCCCGG - Intronic
1057512283 9:95690609-95690631 TGCAGGGAAGGCAGAAGCCTGGG - Intergenic
1057563705 9:96149713-96149735 TGCAGGAAATGCAGCAGCCCCGG - Intergenic
1058394725 9:104538047-104538069 TGCAAGAAATGCAGAATCTCAGG - Intergenic
1058907233 9:109491790-109491812 TGCAGGGACTGCAAGAGCCTGGG - Intronic
1059170070 9:112116509-112116531 AGCAGGGAATGAAAGAGCCCTGG - Intronic
1059307681 9:113367592-113367614 TGCAGGGGTTCCAGAGGCCCAGG + Intronic
1059349224 9:113652677-113652699 TGCAGGGAATACAAAATCTCTGG - Intergenic
1059859046 9:118436739-118436761 TGTATGGAATGCAAAAGACCTGG - Intergenic
1060648715 9:125305745-125305767 TGCAAGGACTGCATGAGCCCAGG - Intronic
1061538498 9:131264421-131264443 TGCAGCGGGTGCAGCAGCCCAGG + Intronic
1061538937 9:131266924-131266946 TGCAGGATAAGCAGAAGCTCAGG - Intronic
1061659183 9:132116987-132117009 GCCAGGGAAGGCAGAAGACCTGG - Intergenic
1061775491 9:132960389-132960411 TGTAGGCAACGCAGAACCCCTGG + Intronic
1061881705 9:133572197-133572219 TACAGGGCAGGCAGAGGCCCTGG - Intronic
1062093112 9:134688939-134688961 TGCAGGGAAGACAGCAGCCTGGG - Intronic
1062514583 9:136926195-136926217 TGCAGTGAAGGGAGAGGCCCTGG + Exonic
1062721803 9:138048421-138048443 TGCAGGGAATTTAGGAGCCCAGG + Intronic
1185627711 X:1494102-1494124 TGCAGGGAGGGCAGACGTCCTGG + Intronic
1186249042 X:7646310-7646332 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1186683145 X:11896897-11896919 TGCTAGAAATGCAGAATCCCAGG - Intergenic
1188114076 X:26222818-26222840 TGGTGGGAATAGAGAAGCCCTGG + Intergenic
1188140830 X:26548417-26548439 TGAAGGGAATGATGAAGTCCTGG - Intergenic
1188452185 X:30319294-30319316 TGTTAGGAATGCAGAAGCTCAGG + Intergenic
1188492976 X:30755721-30755743 TGCCGGGATTCCAGAGGCCCAGG - Intergenic
1189176901 X:38966606-38966628 TGCAGCTAAAGCAGAAGCCCAGG - Intergenic
1190144268 X:47876434-47876456 TACAGGAAATGAACAAGCCCAGG + Intronic
1190727116 X:53196953-53196975 AACAGGGACTGCAGTAGCCCTGG + Exonic
1192232124 X:69272653-69272675 TGATAGGAATGCAGAAGCTCAGG - Intergenic
1196918104 X:120560402-120560424 TGAAGGGGATGCCGAATCCCTGG + Exonic
1197444566 X:126534886-126534908 CACAGGGACTGCAGAATCCCTGG + Intergenic
1198851441 X:140968806-140968828 TGTTGGGAATGCAGAATCTCAGG + Intergenic
1199788651 X:151128939-151128961 TGCAGACAATGCAGAAGTTCAGG - Intergenic
1200038192 X:153346667-153346689 AGCAAGGACTGCAGAAGCCAGGG - Intronic
1200102869 X:153696738-153696760 GGCAGGGAAGGCAGCAGCCCAGG + Intergenic
1200267875 X:154655518-154655540 GGCAGGGAAGGCAGCAGCCCAGG + Intergenic
1201758438 Y:17514653-17514675 TGCAGGGAATTCAGAGGGCTTGG - Intergenic
1201843117 Y:18391337-18391359 TGCAGGGAATTCAGAGGGCTTGG + Intergenic