ID: 1040073675

View in Genome Browser
Species Human (GRCh38)
Location 8:43208237-43208259
Sequence GGTCAGCCCGGCTCTACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040073675_1040073682 23 Left 1040073675 8:43208237-43208259 CCTTGTGTAGAGCCGGGCTGACC No data
Right 1040073682 8:43208283-43208305 GCCCACACCTAACAGTCTCAGGG No data
1040073675_1040073688 30 Left 1040073675 8:43208237-43208259 CCTTGTGTAGAGCCGGGCTGACC No data
Right 1040073688 8:43208290-43208312 CCTAACAGTCTCAGGGTATGGGG No data
1040073675_1040073681 22 Left 1040073675 8:43208237-43208259 CCTTGTGTAGAGCCGGGCTGACC No data
Right 1040073681 8:43208282-43208304 TGCCCACACCTAACAGTCTCAGG No data
1040073675_1040073686 29 Left 1040073675 8:43208237-43208259 CCTTGTGTAGAGCCGGGCTGACC No data
Right 1040073686 8:43208289-43208311 ACCTAACAGTCTCAGGGTATGGG No data
1040073675_1040073685 28 Left 1040073675 8:43208237-43208259 CCTTGTGTAGAGCCGGGCTGACC No data
Right 1040073685 8:43208288-43208310 CACCTAACAGTCTCAGGGTATGG No data
1040073675_1040073680 -2 Left 1040073675 8:43208237-43208259 CCTTGTGTAGAGCCGGGCTGACC No data
Right 1040073680 8:43208258-43208280 CCACACTGGATCTAATGGAGAGG No data
1040073675_1040073678 -7 Left 1040073675 8:43208237-43208259 CCTTGTGTAGAGCCGGGCTGACC No data
Right 1040073678 8:43208253-43208275 GCTGACCACACTGGATCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040073675 Original CRISPR GGTCAGCCCGGCTCTACACA AGG (reversed) Intergenic
No off target data available for this crispr