ID: 1040075034

View in Genome Browser
Species Human (GRCh38)
Location 8:43220549-43220571
Sequence CTGTTTCCACAGAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040075034_1040075039 13 Left 1040075034 8:43220549-43220571 CCCTGCCCACTCTGTGGAAACAG 0: 1
1: 0
2: 4
3: 40
4: 291
Right 1040075039 8:43220585-43220607 ACCCAATGTCACTGAGGAAATGG 0: 1
1: 0
2: 3
3: 18
4: 212
1040075034_1040075043 27 Left 1040075034 8:43220549-43220571 CCCTGCCCACTCTGTGGAAACAG 0: 1
1: 0
2: 4
3: 40
4: 291
Right 1040075043 8:43220599-43220621 AGGAAATGGCCATTGTTTGTGGG 0: 1
1: 0
2: 3
3: 19
4: 219
1040075034_1040075038 7 Left 1040075034 8:43220549-43220571 CCCTGCCCACTCTGTGGAAACAG 0: 1
1: 0
2: 4
3: 40
4: 291
Right 1040075038 8:43220579-43220601 ATTTGCACCCAATGTCACTGAGG 0: 1
1: 0
2: 3
3: 14
4: 127
1040075034_1040075042 26 Left 1040075034 8:43220549-43220571 CCCTGCCCACTCTGTGGAAACAG 0: 1
1: 0
2: 4
3: 40
4: 291
Right 1040075042 8:43220598-43220620 GAGGAAATGGCCATTGTTTGTGG 0: 1
1: 0
2: 3
3: 18
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040075034 Original CRISPR CTGTTTCCACAGAGTGGGCA GGG (reversed) Intergenic
900322539 1:2092263-2092285 CTCTTCACACAGAGGGGGCAGGG - Intronic
900979105 1:6036056-6036078 CAGTTTCCACGGAGTGGTGAGGG + Intronic
901123420 1:6912860-6912882 CTGTTTCCACTGTGTGGGGAGGG + Intronic
901943926 1:12685487-12685509 CTTCTACCACAGAGTGGGCAGGG + Intergenic
901954979 1:12777510-12777532 CTGATGCCACAGCGAGGGCAGGG - Exonic
901972698 1:12920351-12920373 CTGATGCCACAGCGAGGGCAGGG - Exonic
902012482 1:13281411-13281433 CTGATGCCACAGCGAGGGCAGGG + Exonic
902076419 1:13790407-13790429 CTCTTTCCACCAAGTGGACACGG - Intronic
902962813 1:19976832-19976854 CTGTTTCCATGGAGTCGGGAGGG - Intronic
904238299 1:29127952-29127974 CTGTTTCCACAGAGAAGGTTAGG - Intergenic
904331568 1:29761319-29761341 CAGCTTGCTCAGAGTGGGCAGGG + Intergenic
905733121 1:40310041-40310063 CTACAGCCACAGAGTGGGCATGG - Intronic
905933500 1:41806305-41806327 CTGACTACACAGCGTGGGCATGG + Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
907559531 1:55375767-55375789 CTGTTTTCCCACAGTGGGCGAGG - Intergenic
908645755 1:66275945-66275967 CTGTGTCCACAGAGTAAGCTGGG + Intronic
909977673 1:82064308-82064330 CAGTTTCTCCAGGGTGGGCAAGG + Intergenic
911719730 1:101177819-101177841 ATTTTTCCACAGAGTGGGTTGGG - Intergenic
915081656 1:153356905-153356927 CTGTGTTCCCACAGTGGGCAGGG + Intergenic
916619211 1:166477563-166477585 ATTTTTCCACAGAGTGGGGTGGG + Intergenic
917057927 1:171004113-171004135 CTGTTTCCAAGCAGAGGGCAAGG + Intronic
917788924 1:178487176-178487198 CTGTCTGCACTGGGTGGGCAAGG - Intergenic
919924763 1:202186544-202186566 CTGTCCCCGCAGTGTGGGCATGG + Intergenic
920028963 1:203024590-203024612 CTGTTCACACAGAGTGAGCCTGG + Exonic
920573094 1:207032800-207032822 CTGTTTCCTCAGGGAGGGAATGG + Intronic
921253569 1:213319389-213319411 CTCTTTAGACAGAGTAGGCAAGG + Intergenic
923926946 1:238640064-238640086 CTGCTTTCAGAGAGTGGGGAAGG - Intergenic
924013567 1:239694395-239694417 CTGCTTCCACACAGTGGCCTTGG + Intronic
924204484 1:241697791-241697813 CTGATTCCACAGAGTAGATAGGG - Intronic
924694192 1:246382408-246382430 CTGAGTCTATAGAGTGGGCATGG - Intronic
924893391 1:248308816-248308838 ATTTTTCCACTGATTGGGCAGGG - Intergenic
1063142606 10:3268657-3268679 CTGTGTCCACAGGGTGGAAAGGG + Intergenic
1063568892 10:7196397-7196419 CTGATTGCACAGCGTGGGCATGG - Intronic
1063961557 10:11310184-11310206 CTTCTGCCACAGAGTTGGCAGGG + Intronic
1064096338 10:12427234-12427256 CTGATTCCAGAGGGTGGGTAGGG + Intronic
1064506849 10:16040562-16040584 CTGTTTCCCCAGTGTTGGCTGGG - Intergenic
1065366088 10:24938399-24938421 CTGTTTCCACCCAGTGTTCAGGG - Intronic
1066663387 10:37758483-37758505 CTCTGTCCACTGAGGGGGCATGG - Intergenic
1067479730 10:46587060-46587082 CTGTTTCCCCAGAGTGGCAGTGG - Intronic
1067615007 10:47754737-47754759 CTGTTTCCCCAGAGTGGCAGTGG + Intergenic
1069979917 10:72245266-72245288 CTGTGGCCACAGAGTCAGCAGGG - Intergenic
1070354649 10:75627937-75627959 TTGCTTTCACTGAGTGGGCAGGG + Intronic
1070761069 10:79024786-79024808 CTGTTGCCACCAAGTGGGAAAGG + Intergenic
1071630411 10:87214701-87214723 CTGTTTCCCCAGAGTGGCAGTGG + Intergenic
1071829406 10:89356783-89356805 GTTTTTCCACAGACTGGGCAGGG - Intronic
1071964890 10:90842535-90842557 GTGTGCCCACAGAGTGGTCATGG + Intronic
1074141763 10:110679744-110679766 CTGTTTCCTGAGAGAGGGCTTGG + Intronic
1075071210 10:119320962-119320984 CTGTATCCTGAGAGGGGGCAGGG - Intronic
1075290079 10:121221876-121221898 CTGCTACCAGAGGGTGGGCAGGG + Intergenic
1075423553 10:122324416-122324438 CTGTGTCCCCAGGGTGGGCGAGG + Intronic
1075957554 10:126536894-126536916 CAGGTTCCACAGAGTTGGCAGGG - Intronic
1076410596 10:130246271-130246293 ATGTCTCCACCGAGTGGGCTTGG + Intergenic
1077359260 11:2133478-2133500 CTGTCTCTAGAGAGTGGGAAAGG + Intronic
1077502606 11:2916164-2916186 CTGCCTCCCCAGCGTGGGCAAGG - Intronic
1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG + Intergenic
1078812690 11:14784127-14784149 ATTTTTCCACAGACTGGGTAGGG - Intronic
1078885856 11:15499201-15499223 ATGTTTCCTCAGAGGGGACAAGG - Intergenic
1079115465 11:17638080-17638102 AAGTTTCCACAGGGTGGGAAAGG + Intronic
1079381361 11:19940759-19940781 CTGGTTCCACTGCCTGGGCACGG + Intronic
1080600998 11:33820488-33820510 TTCTTCCCACAGAGTGAGCAGGG + Intergenic
1081215874 11:40397168-40397190 ATGTTTCCAGAGATTGGGTAGGG - Intronic
1081775897 11:45675779-45675801 CTGTTTCCACAGCCTGGCCCAGG - Intergenic
1082069042 11:47923864-47923886 CAGTGTCCACAGAGAGAGCAGGG - Intergenic
1082792310 11:57354869-57354891 CTGTTTCAAAGGTGTGGGCAGGG + Intronic
1082998968 11:59274504-59274526 CTGTTTCTCCACAGTGGTCAGGG - Intergenic
1083295816 11:61715155-61715177 CTCATTCCACAGTGTGTGCAAGG - Intronic
1083833230 11:65246888-65246910 CTGTTTTCCCAGAGTAGGCATGG - Intergenic
1084676188 11:70636109-70636131 CTTTGTCGACAGAGTGGTCAGGG - Intronic
1085282504 11:75340434-75340456 CTGTTTCCCCAGAGGGGCCTTGG - Intronic
1088578627 11:111296812-111296834 CTGTTCCTTCAGAGGGGGCAAGG + Intergenic
1089131160 11:116213251-116213273 CTGTTGCCACAAAGAGGCCAAGG + Intergenic
1089439805 11:118505802-118505824 CTGTTACCACAGAGTGTGGGAGG + Exonic
1089772515 11:120813923-120813945 CTGATACCACAGTGTGTGCACGG + Intronic
1090000215 11:122949734-122949756 CAGATTCCACAGCGTGGGCACGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1096519831 12:52178686-52178708 CTGATACCACAGCCTGGGCAAGG - Intronic
1097907799 12:64938378-64938400 CTGTCTCCACCCAGTGGGCCAGG + Intergenic
1098284071 12:68890615-68890637 CTTTTTCCCCAGAGTGGGGTTGG - Intronic
1098427853 12:70385911-70385933 CTGTTTTCACAGAGTTGACCTGG - Intronic
1098498351 12:71163012-71163034 ATGTGGCCACAGAGGGGGCAGGG - Intronic
1099033834 12:77560714-77560736 CAGTTTCCACAGAGGGGGCCAGG - Intergenic
1099702128 12:86098516-86098538 TTGTTTCCACAGTGTGTGAATGG + Intronic
1100033702 12:90224738-90224760 TTGTTTCCAAAAATTGGGCAAGG - Intergenic
1100480905 12:94977971-94977993 CTGTTTCCCCAGATTTGGCATGG - Intronic
1101570406 12:105948356-105948378 CTGAACCCACAGAGTGGGCAAGG - Intergenic
1101842682 12:108339530-108339552 CTGTTTGCGCTCAGTGGGCACGG - Intergenic
1102783953 12:115588710-115588732 CCATTTCCACACAGTGGGCCTGG + Intergenic
1102974943 12:117200011-117200033 CTGTTTAAATAGAGTGGTCAGGG - Intergenic
1104599294 12:130141733-130141755 CTGGTTCCAGAGAGAGGGCAGGG + Intergenic
1104964276 12:132502020-132502042 CTGTTTGTACAGAGAGTGCATGG + Intronic
1106021763 13:25922519-25922541 CTGTTTCCAGTCAGTGGGCAGGG + Intronic
1106461417 13:29973598-29973620 CTCTGTCCAGACAGTGGGCAAGG + Intergenic
1107952510 13:45476649-45476671 CTGTTCCCTCAGTGTGTGCATGG + Intronic
1108853236 13:54761870-54761892 TTGGTTCCACAGCATGGGCATGG - Intergenic
1109072719 13:57789059-57789081 CTCTATCCACAGAGTGGTCCTGG + Intergenic
1110466095 13:75803664-75803686 CAGTTTCTTCAGAGTGGCCATGG - Intronic
1110593455 13:77291804-77291826 CTTTTTCCTCAGAGTGGGCACGG - Intronic
1110999398 13:82159436-82159458 ATGTTTGCCCAGAGTGGGCAGGG - Intergenic
1112065728 13:95790696-95790718 CTGTTTCTTCAGGGTGGGAATGG + Intronic
1112172174 13:96985088-96985110 CTTATTCCAAAGAGTTGGCAGGG - Intergenic
1112929912 13:104720838-104720860 CAGTTTCCTTAGAGTGGGCAGGG + Intergenic
1114704922 14:24715142-24715164 CTGCTTCCACAGTGTGTCCAGGG - Intergenic
1118305432 14:64651186-64651208 ATGTGTCCACAGGTTGGGCAGGG - Intergenic
1118699297 14:68417458-68417480 CTGTTGCAAGAGTGTGGGCAGGG - Intronic
1121668981 14:95693652-95693674 CAGATTCCACAGTGTTGGCATGG + Intergenic
1122117772 14:99536237-99536259 CTGTTTCCACAGGGCGGGCGAGG - Intronic
1122701007 14:103589142-103589164 CTGTTGCCACAGGGAAGGCAGGG - Intronic
1122969380 14:105146310-105146332 CTGATCTCACAGAGTGGCCAGGG + Intronic
1125089184 15:35770819-35770841 CTATTTCCACATAGCAGGCAGGG - Intergenic
1125130411 15:36278470-36278492 CTCTTCCCACAGAGGGAGCAGGG - Intergenic
1127618404 15:60709850-60709872 ATTTTTCCACAGAGTGGGGCAGG - Intronic
1129877807 15:78988194-78988216 CTTCATCCACAAAGTGGGCATGG + Intronic
1132558545 16:583339-583361 CTGGGTACACAGGGTGGGCATGG - Exonic
1136223252 16:28842483-28842505 CTGTTCCCACAGAATGTGAATGG + Exonic
1136639135 16:31547057-31547079 TTATGTTCACAGAGTGGGCAGGG + Intergenic
1136665526 16:31808568-31808590 TTATGTTCACAGAGTGGGCAGGG - Intergenic
1140972480 16:80027113-80027135 CTGTCCCCACAGACTGGGGAGGG - Intergenic
1141389521 16:83652874-83652896 CTGTTTCCACTTAGTGGCTATGG - Intronic
1203143844 16_KI270728v1_random:1786597-1786619 CTGTTTTCACAGCGTGGACCTGG + Intergenic
1142672517 17:1493640-1493662 CTGTTTCCACCCAGTGGGTCGGG + Intergenic
1143121800 17:4612551-4612573 CTGATTCCACAGTTGGGGCAAGG - Intergenic
1143524834 17:7466077-7466099 CTTTTTCCACACTGGGGGCAGGG + Exonic
1143528864 17:7488924-7488946 CTATTTAAACAGAGTGGTCAGGG - Intronic
1143972034 17:10803026-10803048 GTGTGTGCACTGAGTGGGCATGG + Intergenic
1143976192 17:10831746-10831768 CTGATGCCCCAGACTGGGCAAGG + Intronic
1144796309 17:17893626-17893648 CTGTTCCAACAAATTGGGCAAGG + Intronic
1146318299 17:31826374-31826396 CTGTGTCTCCAGAGTGGTCAAGG - Intergenic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1149537329 17:57442993-57443015 CTGTTTCCTCAGAGCAGGGAAGG - Intronic
1151855176 17:76716029-76716051 TTGTTTGCATAGAGTGGGAACGG - Exonic
1152117058 17:78394843-78394865 CTGTTTCTTCAGGCTGGGCACGG - Intronic
1152471714 17:80493188-80493210 CTGTTTCCAGTGAGCGGGGAGGG + Intergenic
1154404410 18:14075466-14075488 CTATGTTCACAAAGTGGGCAGGG - Intronic
1154502441 18:15003535-15003557 CTGTTTACAGAGGCTGGGCAGGG - Intergenic
1155072796 18:22330917-22330939 CTGTCTCCACAAAGAGAGCAAGG + Intergenic
1157370052 18:47102580-47102602 GTTTTTCCACGGAGTGGGCCTGG - Intergenic
1157986886 18:52448282-52448304 ATTTTTCCACAGAGGGGCCAGGG - Intronic
1158539945 18:58344243-58344265 CTGATACCACACAATGGGCAAGG - Intronic
1160057686 18:75500049-75500071 CTGTTTCCACAGAGAAAGGAAGG - Intergenic
1162175019 19:8823975-8823997 CAGTTACCACAGAGGGGACAGGG - Intronic
1162585183 19:11553969-11553991 CTTTTTCCAGAGGGTGGGGAGGG - Intronic
1162624593 19:11874511-11874533 CTGTGTCCACACTGTGGGGAGGG + Intronic
1162629687 19:11917345-11917367 CTGTGTCCACACTGTGGGGAGGG + Intergenic
1162634741 19:11958576-11958598 CTGTGTCCACACTGTGGGGAGGG + Intronic
1163205301 19:15798280-15798302 CTGTTTCCACACCTGGGGCATGG - Intergenic
1163696713 19:18768048-18768070 CAGCATCCCCAGAGTGGGCAAGG + Intronic
1164722668 19:30443953-30443975 CGCTTGCCGCAGAGTGGGCACGG - Exonic
1165271036 19:34707877-34707899 TTGTTTCCACAGAGTGGGAGGGG - Intergenic
1166199412 19:41226603-41226625 CTGTTCCCACCGCGTTGGCAAGG - Intronic
1166600434 19:44089325-44089347 CTGTTTCCACAAACTTGGGAAGG + Exonic
1167812776 19:51849115-51849137 CTATTTCCACAGTTTGGGGAAGG + Intergenic
1167822502 19:51941384-51941406 CTGTCTCCAAAGAGTGGTCTTGG + Intronic
1167826685 19:51979673-51979695 CTGGGTCCACAGAGTGGGGTAGG - Intronic
1167833419 19:52046362-52046384 CTGTTTCCACTGAGTTTGCCTGG + Intronic
1167979996 19:53267392-53267414 CTATCTCCATAGAGTGGGCAGGG - Exonic
1167985889 19:53315391-53315413 CTATCTCCATAGAGTGGGCAGGG + Intergenic
1167998093 19:53423050-53423072 TTGTGTCCACAGAGTTGTCAGGG + Intronic
1168007571 19:53503644-53503666 TTGTGTCCACAGAGTTGTCAGGG + Intergenic
1168494447 19:56838100-56838122 ATGATGCCACAGAGTGGGCGGGG + Intronic
1168564559 19:57412232-57412254 ATTGTTCCACAGAGTGGGCCTGG - Intronic
925744182 2:7030700-7030722 GTTTTTCCACAGACTGGGCAGGG + Intronic
926161943 2:10495505-10495527 CGGCTTCCTCAGAGTGTGCAGGG - Intergenic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
928660294 2:33495243-33495265 GTTTTTCCACAGACAGGGCAGGG + Intronic
930540838 2:52704601-52704623 TTGTTTCCACAGAAAAGGCAAGG - Intergenic
930752389 2:54945924-54945946 CTGTTTCCACAGGGGGTACAGGG + Intronic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
933938249 2:87224528-87224550 CATTTTACACAGAGTGGTCAGGG - Intergenic
934663689 2:96156284-96156306 CTGTTTCCACTGGGTGGGGGTGG - Intergenic
935565161 2:104598525-104598547 ATTTTTCCACAGACTGGGTAGGG + Intergenic
935673745 2:105576780-105576802 CTGTTTTCACAAGGTGGGCTTGG - Intergenic
936354886 2:111741247-111741269 CATTTTACACAGAGTGGTCAGGG + Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938501616 2:131833707-131833729 CTGTTTACAGAGGCTGGGCAGGG - Intergenic
939145577 2:138410733-138410755 GTGTATCCAAAGAGTGAGCAAGG - Intergenic
940990698 2:160093132-160093154 GTTTTTCCACAGACTGGCCAAGG + Intergenic
942358422 2:175145149-175145171 CTGTGTCCACTGAGAGGGCCTGG + Intronic
945947093 2:216004860-216004882 CTGTTTTAAGAGAGTGGTCAGGG + Intronic
946249005 2:218401858-218401880 CAGTTTCCCCACAGTGGGCAGGG - Intronic
946285845 2:218701900-218701922 CTGATTCCCCAGAGAGAGCAAGG - Exonic
947021844 2:225686771-225686793 GTGTTTCCACACAGTGGGCAAGG - Intergenic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
947792411 2:232875958-232875980 CTCGTTCCACAGCGTGGGCACGG - Exonic
948665867 2:239534651-239534673 CTGTTTCTACAGTCTGGGCCAGG - Intergenic
948885215 2:240878863-240878885 CTGATCCCTCAGGGTGGGCATGG - Exonic
1169031164 20:2408228-2408250 CTGGTTCCACAGACAGAGCAAGG - Intronic
1169641188 20:7754293-7754315 ATGTGTCCACAAAGTTGGCAAGG - Intergenic
1172151858 20:32796409-32796431 CTGTTTACAGGGTGTGGGCATGG + Intronic
1173860039 20:46277372-46277394 CTGTGTCCACAGAGAGGACAAGG - Intronic
1175516874 20:59575688-59575710 CTGGGTCCACAGAGTGGGGAAGG + Intergenic
1175887432 20:62300457-62300479 CTGTGGCCACAGAGTGGGTGGGG - Intergenic
1176272814 20:64245271-64245293 CTGTGTCCACATGCTGGGCAGGG - Intergenic
1176520504 21:7820698-7820720 CTGTATACTCAGAGTGGGCCTGG + Intronic
1176993957 21:15532133-15532155 CTGTTTGCACAGTATAGGCAAGG + Intergenic
1178238168 21:30868053-30868075 CTGTTTTCAAAGAGTGGGTTTGG + Intergenic
1178654526 21:34450710-34450732 CTGTATACTCAGAGTGGGCCTGG + Intergenic
1179117756 21:38509660-38509682 ATGTTTCCAGAGAATGGGAATGG - Intronic
1180761109 22:18208618-18208640 ATTTTTCCACGGAGTGGGGATGG + Intergenic
1180774558 22:18416001-18416023 ATTTTTCCACGGAGTGGGGATGG - Intergenic
1180807711 22:18726820-18726842 ATTTTTCCACGGAGTGGGGATGG - Intergenic
1181070670 22:20335009-20335031 ATTTTTCCACGGAGTGGGGATGG - Intergenic
1181116777 22:20636469-20636491 CTCTGTCCTCAGAGTGGACATGG - Intergenic
1181193655 22:21162953-21162975 ATTTTTCCACGGAGTGGGGATGG - Intergenic
1181215788 22:21329646-21329668 ATTTTTCCACGGAGTGGGGATGG + Intergenic
1182163070 22:28143086-28143108 CAGTTTCCACAGAGAGGGAAAGG - Intronic
1183591691 22:38782825-38782847 CTGCTCCCACCGAGTTGGCAGGG - Exonic
1183668173 22:39256973-39256995 CTGCTTCCCCTGAGTGGCCAGGG - Intergenic
1184462596 22:44647755-44647777 CCTCTTCCACAGAGAGGGCAGGG + Intergenic
1185184044 22:49381933-49381955 CTGTTCCCCCAGACTGTGCACGG - Intergenic
1185294725 22:50047488-50047510 CGGTTTCCACAGAGGGGCCTCGG + Intronic
1185347934 22:50318693-50318715 GTGCCTCCACGGAGTGGGCATGG + Intronic
950583873 3:13879695-13879717 GTGTTTCGACAAAGTTGGCACGG - Intronic
952265158 3:31778201-31778223 CAGTTCCCACACAGTTGGCAAGG - Intronic
953771018 3:45778794-45778816 CTGTTTCCACTGAGAAGGCTGGG + Intronic
953904146 3:46859926-46859948 CTGTTTCCCAAAAGTAGGCAAGG - Intronic
955918983 3:63934732-63934754 CAGTTTCCTCAAAGTGGGCATGG + Intronic
958634774 3:96729818-96729840 CTGCTGCCATAGGGTGGGCACGG + Intergenic
959135261 3:102410831-102410853 CTGTGTTCACAGAGAGGGTAGGG + Intronic
959921390 3:111872169-111872191 ATGTATCCACAGAATGGGCTGGG - Intronic
960983136 3:123250535-123250557 CTGCTTCCTAAGAGTGGGCTGGG - Intronic
961662532 3:128477321-128477343 CTGTTGCCACAGTGAGGGCAGGG - Intergenic
962401889 3:135067564-135067586 CAGTTTCCAGGCAGTGGGCAAGG + Intronic
962468842 3:135687198-135687220 ATTTTTCCACAGACTGGGCAGGG - Intergenic
962490062 3:135884489-135884511 CCTTTTCCAGAGAGTGAGCAGGG + Intergenic
962636465 3:137337155-137337177 CTGTTTCTAAATTGTGGGCATGG + Intergenic
964237144 3:154545053-154545075 CTGTTTACAAATCGTGGGCAGGG + Intergenic
964894166 3:161574793-161574815 CTGGTTACACAGAGAGGTCAAGG - Intergenic
965729736 3:171758554-171758576 CTGTTTCCAGAGTGTGGCCAAGG - Intronic
965971170 3:174558329-174558351 GTTTTTCCACAGACTGGGTACGG + Intronic
966224388 3:177582312-177582334 CTCTTTGCACAGAGGAGGCAGGG + Intergenic
968505853 4:971214-971236 CTCTCTCCAATGAGTGGGCAGGG - Intronic
968622903 4:1611689-1611711 CTCTGTCCACACGGTGGGCAAGG + Intergenic
968921205 4:3523005-3523027 CTCTTTCCTGAGTGTGGGCAGGG + Intronic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
973140839 4:46766008-46766030 CTGTGTCCACTGAGTGGACCTGG - Intronic
973214678 4:47655593-47655615 CTCTTTCCACAGAGAGGTAATGG - Intronic
978105963 4:104902164-104902186 CTGTTTCCTCAGTGTGGACTTGG - Intergenic
978754473 4:112287076-112287098 CTTTTTCCACAGACTGGGGTTGG + Intronic
980878608 4:138686951-138686973 CAGTTTTCACAGGGTGGTCAGGG - Intergenic
982187589 4:152818652-152818674 CTGCTTCCACAGACTGGGAATGG + Intronic
982873275 4:160611677-160611699 CTGATTCCACAGGGTTGGAATGG + Intergenic
984180686 4:176479124-176479146 CAGGTCCCACAGAGTGGGCTTGG + Intergenic
986202232 5:5589142-5589164 CTGTTTGCACATAGTTTGCAGGG - Intergenic
986573127 5:9185854-9185876 CTTTTTCCACAGCATGGCCATGG - Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991961026 5:72044377-72044399 CTGTTGCCAAAGAATGGGCAAGG + Intergenic
995486335 5:112643950-112643972 CTGTTCTCATAGAGTGGTCATGG - Intergenic
995501045 5:112807190-112807212 CACTTTCCACAGGCTGGGCATGG - Intronic
996465916 5:123802699-123802721 CAGTGTCCACAGACTGGGAAGGG + Intergenic
997391750 5:133522940-133522962 GTGTTTCCACAGAATGTGTAAGG + Intronic
997592954 5:135086783-135086805 CTTCTTCCACACAGTGGCCACGG - Intronic
998674280 5:144389660-144389682 TTTTTTCCACAGATTGGGCCAGG - Intronic
999190845 5:149746105-149746127 CTGCTTCCACAGTGTGGTCAGGG + Intronic
1001026444 5:168228150-168228172 CTGTTACCACAGAGTGGGAGGGG + Intronic
1001026451 5:168228208-168228230 CTGTTACCACAGAGTGGGAGGGG + Intronic
1002591437 5:180293453-180293475 CAGGATCCACAGAGTGGCCAGGG + Intergenic
1002921814 6:1578305-1578327 CTGTTGTCACAGACTGGCCACGG + Intergenic
1003011008 6:2427577-2427599 CAGCCTCCACAGAGTGGGGAGGG + Intergenic
1003187883 6:3849118-3849140 CTGTTTTCACGCTGTGGGCAGGG - Intergenic
1006299037 6:33184159-33184181 CTGTCTCCGCAGAGAGGGCAGGG + Intronic
1009842519 6:69094070-69094092 CTGTTTGCACAGTGGAGGCAAGG + Intronic
1010524198 6:76880333-76880355 CTGTTTCTTCAGGCTGGGCATGG - Intergenic
1011334773 6:86248210-86248232 CTGTTTCCACAGTGTGACAAAGG - Intergenic
1011528278 6:88290725-88290747 CTGTTTCCACTGAGTAACCATGG - Intergenic
1012103812 6:95127239-95127261 CAGATTCTACAAAGTGGGCAAGG - Intergenic
1012696454 6:102390801-102390823 CTGCTTACACACAGTTGGCAAGG - Intergenic
1013089211 6:106884255-106884277 CTGTTTCCACAGGGTAACCAGGG - Intergenic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1014403172 6:121015863-121015885 CTTGTTCCACAGAGTGGGGATGG - Intergenic
1016137795 6:140567646-140567668 GGGTTTCCACAGGGTGGGGATGG - Intergenic
1017823562 6:158065400-158065422 CTGTTTCCACAGGGTCCTCAGGG - Intronic
1018034579 6:159871427-159871449 CTGTTTTCAAAGGGTGTGCATGG - Intergenic
1019103627 6:169651019-169651041 GTGTTTACACAGAGTGGCCTGGG + Intronic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019666176 7:2253262-2253284 CTGTGTCTCCAGAGTAGGCAAGG - Exonic
1019682927 7:2362669-2362691 CAGCATCCACAGCGTGGGCAGGG - Exonic
1020259979 7:6525896-6525918 CTGTGTCCACAGGGAGGGCCGGG - Intronic
1021743334 7:23710726-23710748 CTGTTTGCAGAAAGTGGGTACGG + Intronic
1022647104 7:32241821-32241843 CTGTATCCACAGAGAGGAGATGG + Intronic
1023318260 7:38964255-38964277 CAGCTTCAACAGAGTGGGCAAGG + Intergenic
1023783699 7:43684127-43684149 TTTTTTCCACAGAGGAGGCAGGG + Intronic
1024941399 7:54767052-54767074 CTGGTTGCAGAGAGTGGCCATGG + Intergenic
1026392233 7:69913049-69913071 GTGTTTACAGAGAGTGGGAAAGG - Intronic
1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG + Intronic
1027428764 7:78088497-78088519 CTGTTTTCGAAGAATGGGCAGGG + Intronic
1028297148 7:89148002-89148024 ATTTTTCCACAGACAGGGCAAGG - Intronic
1032266920 7:130375967-130375989 ATGTGGCCTCAGAGTGGGCAAGG + Intergenic
1032319083 7:130868358-130868380 TTGTTTCCGTACAGTGGGCAGGG + Intergenic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1035130505 7:156648287-156648309 CTGTTTCCACAGCGACGCCAGGG + Intronic
1035709725 8:1703342-1703364 CTATTTCCCCAGAGTGTTCAAGG + Exonic
1037882971 8:22581815-22581837 CTGGTTCCCAAGAGTGTGCAGGG + Intronic
1040075034 8:43220549-43220571 CTGTTTCCACAGAGTGGGCAGGG - Intergenic
1040434561 8:47377697-47377719 CTGTGTAGACAGAGTGGTCAAGG + Intronic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1043102909 8:76068990-76069012 ATCTTTCCACTGAGTGGGCTGGG - Intergenic
1043971739 8:86537171-86537193 CTGTCTCCATAGAGTTGGTATGG + Intronic
1045146209 8:99347290-99347312 CTTCTTCCACAGTGTGGGCTAGG + Intronic
1045256754 8:100531484-100531506 CTCTTTCCACAGAGAGCCCATGG - Intronic
1045872905 8:106946410-106946432 CTTTTTCCACAGATTGGTCCAGG + Intergenic
1046382492 8:113470206-113470228 TACATTCCACAGAGTGGGCATGG + Intergenic
1047208802 8:122824157-122824179 AGGTTTCCACAGGGTGGACAAGG - Intronic
1047483579 8:125308008-125308030 CTGTTTCCACAGGGGAAGCAGGG - Intronic
1048689669 8:136947385-136947407 CTGTTTCCATACAGTGGGCATGG - Intergenic
1050569403 9:6921828-6921850 GTGTTGGTACAGAGTGGGCAAGG - Intronic
1057011265 9:91603850-91603872 CTATTTTCACAGAGAGGGCAAGG - Intronic
1057037853 9:91824780-91824802 CTGGTTCCAGAGCGTGGGGACGG - Intronic
1058082586 9:100715623-100715645 CAGTTTCCACATGGTGTGCATGG + Intergenic
1058342861 9:103920105-103920127 CAGTTCCCACACAGTTGGCAAGG - Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1060157229 9:121328157-121328179 CTGTTTCCAGAATGTGGGCCGGG + Intronic
1060744917 9:126124960-126124982 CTGTTTCCAAAGGCTGGGAAAGG + Intergenic
1060954854 9:127631372-127631394 ATGTGTCCAGAGACTGGGCAGGG - Intronic
1061272606 9:129551854-129551876 CTGTGGGAACAGAGTGGGCAAGG - Intergenic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061880786 9:133567905-133567927 CTGTGTCCAGAAAGGGGGCATGG - Intronic
1062088945 9:134664002-134664024 CTGATTCCCGAGGGTGGGCAGGG - Intronic
1062355819 9:136161751-136161773 CTGTTTCCAAAGAAAGGGAAGGG - Intergenic
1062498056 9:136840842-136840864 CTGTTTACAGAGGCTGGGCAGGG + Exonic
1188686504 X:33076373-33076395 CTCTGTCTAGAGAGTGGGCAAGG + Intronic
1188852568 X:35150392-35150414 CTGTTCCCCCAGAGTTGTCAGGG - Intergenic
1189666173 X:43357339-43357361 GTGTTTCCAGAATGTGGGCAAGG - Intergenic
1190458854 X:50651067-50651089 TTGTTTCAACACACTGGGCATGG - Intronic
1191262991 X:58348477-58348499 CTGTTTCCTCAGAATCTGCAAGG + Intergenic
1193006496 X:76625207-76625229 CTGTTTCCAGAGTGTGAGAAGGG + Intergenic
1193251039 X:79290801-79290823 CAGTTCCCACACAGTGGGCAAGG - Intergenic
1194762737 X:97813804-97813826 CTGTTATCTCAGAATGGGCACGG + Intergenic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1197846027 X:130804087-130804109 CTTTTACCAGAGGGTGGGCAGGG - Intronic
1202168522 Y:22017090-22017112 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG + Intergenic
1202320276 Y:23626382-23626404 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202550491 Y:26043674-26043696 CTGTTTCCACAGAGTCATGAAGG + Intergenic