ID: 1040077164

View in Genome Browser
Species Human (GRCh38)
Location 8:43247468-43247490
Sequence CTGCGGGGCTGCGGGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040077164_1040077187 22 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077187 8:43247513-43247535 AGCACCTGGGGCGGGGATCTTGG No data
1040077164_1040077181 13 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077181 8:43247504-43247526 AAGCCCCGCAGCACCTGGGGCGG No data
1040077164_1040077182 14 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077182 8:43247505-43247527 AGCCCCGCAGCACCTGGGGCGGG No data
1040077164_1040077178 9 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077178 8:43247500-43247522 CCCGAAGCCCCGCAGCACCTGGG No data
1040077164_1040077180 10 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077180 8:43247501-43247523 CCGAAGCCCCGCAGCACCTGGGG No data
1040077164_1040077176 8 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077176 8:43247499-43247521 CCCCGAAGCCCCGCAGCACCTGG No data
1040077164_1040077183 15 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077183 8:43247506-43247528 GCCCCGCAGCACCTGGGGCGGGG No data
1040077164_1040077188 25 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077164_1040077190 26 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077190 8:43247517-43247539 CCTGGGGCGGGGATCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040077164 Original CRISPR CTGCGGGGCTGCGGGGCTGC GGG (reversed) Intergenic