ID: 1040077172

View in Genome Browser
Species Human (GRCh38)
Location 8:43247491-43247513
Sequence TGCGGGGCTTCGGGGCTACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040077172_1040077190 3 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077190 8:43247517-43247539 CCTGGGGCGGGGATCTTGGAGGG No data
1040077172_1040077182 -9 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077182 8:43247505-43247527 AGCCCCGCAGCACCTGGGGCGGG No data
1040077172_1040077191 9 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077191 8:43247523-43247545 GCGGGGATCTTGGAGGGCGCCGG No data
1040077172_1040077192 10 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077192 8:43247524-43247546 CGGGGATCTTGGAGGGCGCCGGG No data
1040077172_1040077181 -10 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077181 8:43247504-43247526 AAGCCCCGCAGCACCTGGGGCGG No data
1040077172_1040077188 2 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077172_1040077183 -8 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077183 8:43247506-43247528 GCCCCGCAGCACCTGGGGCGGGG No data
1040077172_1040077193 19 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077193 8:43247533-43247555 TGGAGGGCGCCGGGCACCCTCGG No data
1040077172_1040077187 -1 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077187 8:43247513-43247535 AGCACCTGGGGCGGGGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040077172 Original CRISPR TGCGGGGCTTCGGGGCTACG GGG (reversed) Intergenic