ID: 1040077174

View in Genome Browser
Species Human (GRCh38)
Location 8:43247493-43247515
Sequence GCTGCGGGGCTTCGGGGCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040077174_1040077193 17 Left 1040077174 8:43247493-43247515 CCGTAGCCCCGAAGCCCCGCAGC No data
Right 1040077193 8:43247533-43247555 TGGAGGGCGCCGGGCACCCTCGG No data
1040077174_1040077188 0 Left 1040077174 8:43247493-43247515 CCGTAGCCCCGAAGCCCCGCAGC No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077174_1040077187 -3 Left 1040077174 8:43247493-43247515 CCGTAGCCCCGAAGCCCCGCAGC No data
Right 1040077187 8:43247513-43247535 AGCACCTGGGGCGGGGATCTTGG No data
1040077174_1040077190 1 Left 1040077174 8:43247493-43247515 CCGTAGCCCCGAAGCCCCGCAGC No data
Right 1040077190 8:43247517-43247539 CCTGGGGCGGGGATCTTGGAGGG No data
1040077174_1040077192 8 Left 1040077174 8:43247493-43247515 CCGTAGCCCCGAAGCCCCGCAGC No data
Right 1040077192 8:43247524-43247546 CGGGGATCTTGGAGGGCGCCGGG No data
1040077174_1040077191 7 Left 1040077174 8:43247493-43247515 CCGTAGCCCCGAAGCCCCGCAGC No data
Right 1040077191 8:43247523-43247545 GCGGGGATCTTGGAGGGCGCCGG No data
1040077174_1040077183 -10 Left 1040077174 8:43247493-43247515 CCGTAGCCCCGAAGCCCCGCAGC No data
Right 1040077183 8:43247506-43247528 GCCCCGCAGCACCTGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040077174 Original CRISPR GCTGCGGGGCTTCGGGGCTA CGG (reversed) Intergenic