ID: 1040077179

View in Genome Browser
Species Human (GRCh38)
Location 8:43247501-43247523
Sequence CCCCAGGTGCTGCGGGGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040077179_1040077191 -1 Left 1040077179 8:43247501-43247523 CCGAAGCCCCGCAGCACCTGGGG No data
Right 1040077191 8:43247523-43247545 GCGGGGATCTTGGAGGGCGCCGG No data
1040077179_1040077197 27 Left 1040077179 8:43247501-43247523 CCGAAGCCCCGCAGCACCTGGGG No data
Right 1040077197 8:43247551-43247573 CTCGGAACAGCGAAGCCAAACGG No data
1040077179_1040077190 -7 Left 1040077179 8:43247501-43247523 CCGAAGCCCCGCAGCACCTGGGG No data
Right 1040077190 8:43247517-43247539 CCTGGGGCGGGGATCTTGGAGGG No data
1040077179_1040077188 -8 Left 1040077179 8:43247501-43247523 CCGAAGCCCCGCAGCACCTGGGG No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077179_1040077192 0 Left 1040077179 8:43247501-43247523 CCGAAGCCCCGCAGCACCTGGGG No data
Right 1040077192 8:43247524-43247546 CGGGGATCTTGGAGGGCGCCGGG No data
1040077179_1040077193 9 Left 1040077179 8:43247501-43247523 CCGAAGCCCCGCAGCACCTGGGG No data
Right 1040077193 8:43247533-43247555 TGGAGGGCGCCGGGCACCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040077179 Original CRISPR CCCCAGGTGCTGCGGGGCTT CGG (reversed) Intergenic