ID: 1040077188

View in Genome Browser
Species Human (GRCh38)
Location 8:43247516-43247538
Sequence ACCTGGGGCGGGGATCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040077168_1040077188 16 Left 1040077168 8:43247477-43247499 CCGCAGCCCCGCAGCCCCGTAGC No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077174_1040077188 0 Left 1040077174 8:43247493-43247515 CCGTAGCCCCGAAGCCCCGCAGC No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077166_1040077188 18 Left 1040077166 8:43247475-43247497 CCCCGCAGCCCCGCAGCCCCGTA No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077163_1040077188 26 Left 1040077163 8:43247467-43247489 CCCCGCAGCCCCGCAGCCCCGCA No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077175_1040077188 -6 Left 1040077175 8:43247499-43247521 CCCCGAAGCCCCGCAGCACCTGG No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077177_1040077188 -7 Left 1040077177 8:43247500-43247522 CCCGAAGCCCCGCAGCACCTGGG No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077179_1040077188 -8 Left 1040077179 8:43247501-43247523 CCGAAGCCCCGCAGCACCTGGGG No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077171_1040077188 8 Left 1040077171 8:43247485-43247507 CCGCAGCCCCGTAGCCCCGAAGC No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077167_1040077188 17 Left 1040077167 8:43247476-43247498 CCCGCAGCCCCGCAGCCCCGTAG No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077169_1040077188 10 Left 1040077169 8:43247483-43247505 CCCCGCAGCCCCGTAGCCCCGAA No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077165_1040077188 24 Left 1040077165 8:43247469-43247491 CCGCAGCCCCGCAGCCCCGCAGC 0: 31
1: 28
2: 67
3: 229
4: 970
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077172_1040077188 2 Left 1040077172 8:43247491-43247513 CCCCGTAGCCCCGAAGCCCCGCA No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077164_1040077188 25 Left 1040077164 8:43247468-43247490 CCCGCAGCCCCGCAGCCCCGCAG No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077173_1040077188 1 Left 1040077173 8:43247492-43247514 CCCGTAGCCCCGAAGCCCCGCAG No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data
1040077170_1040077188 9 Left 1040077170 8:43247484-43247506 CCCGCAGCCCCGTAGCCCCGAAG No data
Right 1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040077188 Original CRISPR ACCTGGGGCGGGGATCTTGG AGG Intergenic