ID: 1040080347

View in Genome Browser
Species Human (GRCh38)
Location 8:43277288-43277310
Sequence CGGCGCCGCCACCTGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040080335_1040080347 10 Left 1040080335 8:43277255-43277277 CCTGCGGCCTCCGGAGCCGCCGC No data
Right 1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG No data
1040080340_1040080347 -9 Left 1040080340 8:43277274-43277296 CCGCCTCCAGCCCTCGGCGCCGC No data
Right 1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG No data
1040080339_1040080347 -6 Left 1040080339 8:43277271-43277293 CCGCCGCCTCCAGCCCTCGGCGC No data
Right 1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG No data
1040080337_1040080347 0 Left 1040080337 8:43277265-43277287 CCGGAGCCGCCGCCTCCAGCCCT No data
Right 1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG No data
1040080332_1040080347 19 Left 1040080332 8:43277246-43277268 CCGCCATGTCCTGCGGCCTCCGG No data
Right 1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG No data
1040080334_1040080347 16 Left 1040080334 8:43277249-43277271 CCATGTCCTGCGGCCTCCGGAGC No data
Right 1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG No data
1040080336_1040080347 3 Left 1040080336 8:43277262-43277284 CCTCCGGAGCCGCCGCCTCCAGC No data
Right 1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040080347 Original CRISPR CGGCGCCGCCACCTGGGAGC CGG Intergenic
No off target data available for this crispr