ID: 1040105311

View in Genome Browser
Species Human (GRCh38)
Location 8:43538203-43538225
Sequence GGTTTAGTAAAACCACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040105311_1040105317 7 Left 1040105311 8:43538203-43538225 CCCTGAGGTGGTTTTACTAAACC No data
Right 1040105317 8:43538233-43538255 CAGAACTGTGGCTGTGGCTCAGG No data
1040105311_1040105319 9 Left 1040105311 8:43538203-43538225 CCCTGAGGTGGTTTTACTAAACC No data
Right 1040105319 8:43538235-43538257 GAACTGTGGCTGTGGCTCAGGGG No data
1040105311_1040105316 1 Left 1040105311 8:43538203-43538225 CCCTGAGGTGGTTTTACTAAACC No data
Right 1040105316 8:43538227-43538249 TAAACTCAGAACTGTGGCTGTGG No data
1040105311_1040105313 -5 Left 1040105311 8:43538203-43538225 CCCTGAGGTGGTTTTACTAAACC No data
Right 1040105313 8:43538221-43538243 AAACCCTAAACTCAGAACTGTGG No data
1040105311_1040105318 8 Left 1040105311 8:43538203-43538225 CCCTGAGGTGGTTTTACTAAACC No data
Right 1040105318 8:43538234-43538256 AGAACTGTGGCTGTGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040105311 Original CRISPR GGTTTAGTAAAACCACCTCA GGG (reversed) Intergenic
No off target data available for this crispr