ID: 1040106161

View in Genome Browser
Species Human (GRCh38)
Location 8:43543272-43543294
Sequence TCTGGATTGTGTAGAAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040106161_1040106162 -7 Left 1040106161 8:43543272-43543294 CCTGGATTTCTACACAATCCAGA No data
Right 1040106162 8:43543288-43543310 ATCCAGACCTGCTGTTCATTCGG No data
1040106161_1040106169 24 Left 1040106161 8:43543272-43543294 CCTGGATTTCTACACAATCCAGA No data
Right 1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG No data
1040106161_1040106166 14 Left 1040106161 8:43543272-43543294 CCTGGATTTCTACACAATCCAGA No data
Right 1040106166 8:43543309-43543331 GGAGTCTGGTCCTTCCACAGAGG No data
1040106161_1040106165 0 Left 1040106161 8:43543272-43543294 CCTGGATTTCTACACAATCCAGA No data
Right 1040106165 8:43543295-43543317 CCTGCTGTTCATTCGGAGTCTGG No data
1040106161_1040106167 23 Left 1040106161 8:43543272-43543294 CCTGGATTTCTACACAATCCAGA No data
Right 1040106167 8:43543318-43543340 TCCTTCCACAGAGGCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040106161 Original CRISPR TCTGGATTGTGTAGAAATCC AGG (reversed) Intergenic