ID: 1040106163

View in Genome Browser
Species Human (GRCh38)
Location 8:43543290-43543312
Sequence CTCCGAATGAACAGCAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040106163_1040106171 26 Left 1040106163 8:43543290-43543312 CCAGACCTGCTGTTCATTCGGAG No data
Right 1040106171 8:43543339-43543361 GGGAACCTGTGCATTACTCATGG No data
1040106163_1040106166 -4 Left 1040106163 8:43543290-43543312 CCAGACCTGCTGTTCATTCGGAG No data
Right 1040106166 8:43543309-43543331 GGAGTCTGGTCCTTCCACAGAGG No data
1040106163_1040106167 5 Left 1040106163 8:43543290-43543312 CCAGACCTGCTGTTCATTCGGAG No data
Right 1040106167 8:43543318-43543340 TCCTTCCACAGAGGCTGCAGAGG No data
1040106163_1040106169 6 Left 1040106163 8:43543290-43543312 CCAGACCTGCTGTTCATTCGGAG No data
Right 1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040106163 Original CRISPR CTCCGAATGAACAGCAGGTC TGG (reversed) Intergenic