ID: 1040106164

View in Genome Browser
Species Human (GRCh38)
Location 8:43543295-43543317
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040106164_1040106167 0 Left 1040106164 8:43543295-43543317 CCTGCTGTTCATTCGGAGTCTGG No data
Right 1040106167 8:43543318-43543340 TCCTTCCACAGAGGCTGCAGAGG No data
1040106164_1040106171 21 Left 1040106164 8:43543295-43543317 CCTGCTGTTCATTCGGAGTCTGG No data
Right 1040106171 8:43543339-43543361 GGGAACCTGTGCATTACTCATGG No data
1040106164_1040106169 1 Left 1040106164 8:43543295-43543317 CCTGCTGTTCATTCGGAGTCTGG No data
Right 1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG No data
1040106164_1040106166 -9 Left 1040106164 8:43543295-43543317 CCTGCTGTTCATTCGGAGTCTGG No data
Right 1040106166 8:43543309-43543331 GGAGTCTGGTCCTTCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040106164 Original CRISPR CCAGACTCCGAATGAACAGC AGG (reversed) Intergenic