ID: 1040106169

View in Genome Browser
Species Human (GRCh38)
Location 8:43543319-43543341
Sequence CCTTCCACAGAGGCTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040106160_1040106169 25 Left 1040106160 8:43543271-43543293 CCCTGGATTTCTACACAATCCAG No data
Right 1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG No data
1040106164_1040106169 1 Left 1040106164 8:43543295-43543317 CCTGCTGTTCATTCGGAGTCTGG No data
Right 1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG No data
1040106163_1040106169 6 Left 1040106163 8:43543290-43543312 CCAGACCTGCTGTTCATTCGGAG No data
Right 1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG No data
1040106161_1040106169 24 Left 1040106161 8:43543272-43543294 CCTGGATTTCTACACAATCCAGA No data
Right 1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040106169 Original CRISPR CCTTCCACAGAGGCTGCAGA GGG Intergenic
No off target data available for this crispr