ID: 1040120583

View in Genome Browser
Species Human (GRCh38)
Location 8:43680568-43680590
Sequence AAATATCCCCAGATAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040120581_1040120583 -7 Left 1040120581 8:43680552-43680574 CCTATGGTGAAACACCAAATATC No data
Right 1040120583 8:43680568-43680590 AAATATCCCCAGATAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040120583 Original CRISPR AAATATCCCCAGATAGAAAA TGG Intergenic
No off target data available for this crispr