ID: 1040129076

View in Genome Browser
Species Human (GRCh38)
Location 8:43773255-43773277
Sequence CCAAATATACAGATAGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040129072_1040129076 0 Left 1040129072 8:43773232-43773254 CCATTGATGCCAATGAGGCAAAA No data
Right 1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG No data
1040129073_1040129076 -9 Left 1040129073 8:43773241-43773263 CCAATGAGGCAAAACCAAATATA No data
Right 1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG No data
1040129071_1040129076 1 Left 1040129071 8:43773231-43773253 CCCATTGATGCCAATGAGGCAAA No data
Right 1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040129076 Original CRISPR CCAAATATACAGATAGACAC GGG Intergenic
No off target data available for this crispr