ID: 1040138433

View in Genome Browser
Species Human (GRCh38)
Location 8:43882515-43882537
Sequence CCCCGTGGGTGCCCCTAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040138423_1040138433 19 Left 1040138423 8:43882473-43882495 CCAAAAGGAGTGTTTCCTGTGGG No data
Right 1040138433 8:43882515-43882537 CCCCGTGGGTGCCCCTAGTCTGG No data
1040138426_1040138433 4 Left 1040138426 8:43882488-43882510 CCTGTGGGGTAAACCAGCTCCAC No data
Right 1040138433 8:43882515-43882537 CCCCGTGGGTGCCCCTAGTCTGG No data
1040138428_1040138433 -9 Left 1040138428 8:43882501-43882523 CCAGCTCCACACCACCCCGTGGG No data
Right 1040138433 8:43882515-43882537 CCCCGTGGGTGCCCCTAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040138433 Original CRISPR CCCCGTGGGTGCCCCTAGTC TGG Intergenic
No off target data available for this crispr