ID: 1040186377

View in Genome Browser
Species Human (GRCh38)
Location 8:44642858-44642880
Sequence CTAGACAGAGAAGCATTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040186375_1040186377 13 Left 1040186375 8:44642822-44642844 CCTATGCTTAAAATAGGAAATAT No data
Right 1040186377 8:44642858-44642880 CTAGACAGAGAAGCATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040186377 Original CRISPR CTAGACAGAGAAGCATTCTG AGG Intergenic
No off target data available for this crispr