ID: 1040273472

View in Genome Browser
Species Human (GRCh38)
Location 8:45984369-45984391
Sequence CTCTCGGCAGAAACTCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040273472_1040273475 -2 Left 1040273472 8:45984369-45984391 CCTTGTAGAGTTTCTGCCGAGAG No data
Right 1040273475 8:45984390-45984412 AGATCCACTGTTAGTCTGATGGG 0: 1083
1: 3328
2: 4204
3: 2419
4: 2187
1040273472_1040273477 11 Left 1040273472 8:45984369-45984391 CCTTGTAGAGTTTCTGCCGAGAG No data
Right 1040273477 8:45984403-45984425 GTCTGATGGGCTTCCCTTTGTGG 0: 5864
1: 2938
2: 903
3: 329
4: 257
1040273472_1040273478 12 Left 1040273472 8:45984369-45984391 CCTTGTAGAGTTTCTGCCGAGAG No data
Right 1040273478 8:45984404-45984426 TCTGATGGGCTTCCCTTTGTGGG 0: 4645
1: 4506
2: 1938
3: 878
4: 1128
1040273472_1040273474 -3 Left 1040273472 8:45984369-45984391 CCTTGTAGAGTTTCTGCCGAGAG No data
Right 1040273474 8:45984389-45984411 GAGATCCACTGTTAGTCTGATGG 0: 1089
1: 3332
2: 4174
3: 2347
4: 1474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040273472 Original CRISPR CTCTCGGCAGAAACTCTACA AGG (reversed) Intergenic
No off target data available for this crispr