ID: 1040279576

View in Genome Browser
Species Human (GRCh38)
Location 8:46032152-46032174
Sequence CTAATTGACCAGAACTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040279573_1040279576 -6 Left 1040279573 8:46032135-46032157 CCAGAAGCTCCCAGCAACTAATT No data
Right 1040279576 8:46032152-46032174 CTAATTGACCAGAACTCTGCAGG No data
1040279572_1040279576 -5 Left 1040279572 8:46032134-46032156 CCCAGAAGCTCCCAGCAACTAAT No data
Right 1040279576 8:46032152-46032174 CTAATTGACCAGAACTCTGCAGG No data
1040279569_1040279576 6 Left 1040279569 8:46032123-46032145 CCTGGCACCCTCCCAGAAGCTCC No data
Right 1040279576 8:46032152-46032174 CTAATTGACCAGAACTCTGCAGG No data
1040279570_1040279576 -1 Left 1040279570 8:46032130-46032152 CCCTCCCAGAAGCTCCCAGCAAC No data
Right 1040279576 8:46032152-46032174 CTAATTGACCAGAACTCTGCAGG No data
1040279571_1040279576 -2 Left 1040279571 8:46032131-46032153 CCTCCCAGAAGCTCCCAGCAACT No data
Right 1040279576 8:46032152-46032174 CTAATTGACCAGAACTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040279576 Original CRISPR CTAATTGACCAGAACTCTGC AGG Intergenic
No off target data available for this crispr