ID: 1040280219

View in Genome Browser
Species Human (GRCh38)
Location 8:46037126-46037148
Sequence CTTCAGGGATCCACCCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040280219_1040280223 -8 Left 1040280219 8:46037126-46037148 CCAGGGCGGGTGGATCCCTGAAG No data
Right 1040280223 8:46037141-46037163 CCCTGAAGGTCAGGAGTTCAAGG No data
1040280219_1040280227 10 Left 1040280219 8:46037126-46037148 CCAGGGCGGGTGGATCCCTGAAG No data
Right 1040280227 8:46037159-46037181 CAAGGCCAGCCTGGGCAATATGG 0: 17
1: 874
2: 14540
3: 76483
4: 144718
1040280219_1040280226 2 Left 1040280219 8:46037126-46037148 CCAGGGCGGGTGGATCCCTGAAG No data
Right 1040280226 8:46037151-46037173 CAGGAGTTCAAGGCCAGCCTGGG 0: 807
1: 19949
2: 39415
3: 58013
4: 50478
1040280219_1040280225 1 Left 1040280219 8:46037126-46037148 CCAGGGCGGGTGGATCCCTGAAG No data
Right 1040280225 8:46037150-46037172 TCAGGAGTTCAAGGCCAGCCTGG 0: 1206
1: 53455
2: 124953
3: 173481
4: 194059

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040280219 Original CRISPR CTTCAGGGATCCACCCGCCC TGG (reversed) Intergenic
No off target data available for this crispr