ID: 1040280651

View in Genome Browser
Species Human (GRCh38)
Location 8:46040192-46040214
Sequence GGGCAGGGCAGACCGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040280640_1040280651 7 Left 1040280640 8:46040162-46040184 CCCGCCGCGCGTTGGGACATGCC No data
Right 1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG No data
1040280642_1040280651 3 Left 1040280642 8:46040166-46040188 CCGCGCGTTGGGACATGCCCCGC No data
Right 1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG No data
1040280637_1040280651 15 Left 1040280637 8:46040154-46040176 CCTCAGTTCCCGCCGCGCGTTGG No data
Right 1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG No data
1040280641_1040280651 6 Left 1040280641 8:46040163-46040185 CCGCCGCGCGTTGGGACATGCCC No data
Right 1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG No data
1040280636_1040280651 20 Left 1040280636 8:46040149-46040171 CCGGACCTCAGTTCCCGCCGCGC No data
Right 1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040280651 Original CRISPR GGGCAGGGCAGACCGCCAGC AGG Intergenic
No off target data available for this crispr