ID: 1040281553

View in Genome Browser
Species Human (GRCh38)
Location 8:46053030-46053052
Sequence GAACATTTCAGAGCCAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040281551_1040281553 10 Left 1040281551 8:46052997-46053019 CCTGGAAACACTGTTTTTGTACA No data
Right 1040281553 8:46053030-46053052 GAACATTTCAGAGCCAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040281553 Original CRISPR GAACATTTCAGAGCCAGCTG AGG Intergenic
No off target data available for this crispr