ID: 1040283772

View in Genome Browser
Species Human (GRCh38)
Location 8:46089186-46089208
Sequence GGCCACAGGCAGGCCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040283757_1040283772 25 Left 1040283757 8:46089138-46089160 CCAATGGTGCCTGTATCTCTAAC No data
Right 1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG No data
1040283760_1040283772 16 Left 1040283760 8:46089147-46089169 CCTGTATCTCTAACAGAGGGCCC No data
Right 1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG No data
1040283768_1040283772 -7 Left 1040283768 8:46089170-46089192 CCATGGATGACCACGGGGCCACA No data
Right 1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG No data
1040283767_1040283772 -6 Left 1040283767 8:46089169-46089191 CCCATGGATGACCACGGGGCCAC No data
Right 1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG No data
1040283765_1040283772 -4 Left 1040283765 8:46089167-46089189 CCCCCATGGATGACCACGGGGCC No data
Right 1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG No data
1040283766_1040283772 -5 Left 1040283766 8:46089168-46089190 CCCCATGGATGACCACGGGGCCA No data
Right 1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040283772 Original CRISPR GGCCACAGGCAGGCCTGTGA AGG Intergenic
No off target data available for this crispr