ID: 1040285248

View in Genome Browser
Species Human (GRCh38)
Location 8:46097488-46097510
Sequence CCCACCTGGGGGTACCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040285248_1040285258 -1 Left 1040285248 8:46097488-46097510 CCCCATGGGTACCCCCAGGTGGG No data
Right 1040285258 8:46097510-46097532 GAAGCTAGAGCCCTGGGCTTTGG No data
1040285248_1040285256 -8 Left 1040285248 8:46097488-46097510 CCCCATGGGTACCCCCAGGTGGG No data
Right 1040285256 8:46097503-46097525 CAGGTGGGAAGCTAGAGCCCTGG No data
1040285248_1040285263 28 Left 1040285248 8:46097488-46097510 CCCCATGGGTACCCCCAGGTGGG No data
Right 1040285263 8:46097539-46097561 GTGTCTGTGTCTGTCCCAGAAGG No data
1040285248_1040285257 -7 Left 1040285248 8:46097488-46097510 CCCCATGGGTACCCCCAGGTGGG No data
Right 1040285257 8:46097504-46097526 AGGTGGGAAGCTAGAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040285248 Original CRISPR CCCACCTGGGGGTACCCATG GGG (reversed) Intergenic