ID: 1040287788

View in Genome Browser
Species Human (GRCh38)
Location 8:46109323-46109345
Sequence AACAAGGCCACAGGTTGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040287788_1040287798 30 Left 1040287788 8:46109323-46109345 CCACGACAACCTGTGGCCTTGTT No data
Right 1040287798 8:46109376-46109398 AGGCACCATGCTCCAGAACCTGG No data
1040287788_1040287795 10 Left 1040287788 8:46109323-46109345 CCACGACAACCTGTGGCCTTGTT No data
Right 1040287795 8:46109356-46109378 GATCCATCCGCGACGGACACAGG No data
1040287788_1040287794 3 Left 1040287788 8:46109323-46109345 CCACGACAACCTGTGGCCTTGTT No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040287788 Original CRISPR AACAAGGCCACAGGTTGTCG TGG (reversed) Intergenic