ID: 1040287794

View in Genome Browser
Species Human (GRCh38)
Location 8:46109349-46109371
Sequence ACTTGGGGATCCATCCGCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040287781_1040287794 25 Left 1040287781 8:46109301-46109323 CCTTTTAGCCCCTGTCGCCTGCC No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data
1040287782_1040287794 17 Left 1040287782 8:46109309-46109331 CCCCTGTCGCCTGCCCACGACAA No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data
1040287789_1040287794 -6 Left 1040287789 8:46109332-46109354 CCTGTGGCCTTGTTTTCACTTGG No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data
1040287783_1040287794 16 Left 1040287783 8:46109310-46109332 CCCTGTCGCCTGCCCACGACAAC No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data
1040287786_1040287794 8 Left 1040287786 8:46109318-46109340 CCTGCCCACGACAACCTGTGGCC No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data
1040287788_1040287794 3 Left 1040287788 8:46109323-46109345 CCACGACAACCTGTGGCCTTGTT No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data
1040287780_1040287794 26 Left 1040287780 8:46109300-46109322 CCCTTTTAGCCCCTGTCGCCTGC No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data
1040287787_1040287794 4 Left 1040287787 8:46109322-46109344 CCCACGACAACCTGTGGCCTTGT No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data
1040287784_1040287794 15 Left 1040287784 8:46109311-46109333 CCTGTCGCCTGCCCACGACAACC No data
Right 1040287794 8:46109349-46109371 ACTTGGGGATCCATCCGCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040287794 Original CRISPR ACTTGGGGATCCATCCGCGA CGG Intergenic