ID: 1040287795

View in Genome Browser
Species Human (GRCh38)
Location 8:46109356-46109378
Sequence GATCCATCCGCGACGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040287786_1040287795 15 Left 1040287786 8:46109318-46109340 CCTGCCCACGACAACCTGTGGCC No data
Right 1040287795 8:46109356-46109378 GATCCATCCGCGACGGACACAGG No data
1040287789_1040287795 1 Left 1040287789 8:46109332-46109354 CCTGTGGCCTTGTTTTCACTTGG No data
Right 1040287795 8:46109356-46109378 GATCCATCCGCGACGGACACAGG No data
1040287784_1040287795 22 Left 1040287784 8:46109311-46109333 CCTGTCGCCTGCCCACGACAACC No data
Right 1040287795 8:46109356-46109378 GATCCATCCGCGACGGACACAGG No data
1040287783_1040287795 23 Left 1040287783 8:46109310-46109332 CCCTGTCGCCTGCCCACGACAAC No data
Right 1040287795 8:46109356-46109378 GATCCATCCGCGACGGACACAGG No data
1040287788_1040287795 10 Left 1040287788 8:46109323-46109345 CCACGACAACCTGTGGCCTTGTT No data
Right 1040287795 8:46109356-46109378 GATCCATCCGCGACGGACACAGG No data
1040287793_1040287795 -6 Left 1040287793 8:46109339-46109361 CCTTGTTTTCACTTGGGGATCCA No data
Right 1040287795 8:46109356-46109378 GATCCATCCGCGACGGACACAGG No data
1040287782_1040287795 24 Left 1040287782 8:46109309-46109331 CCCCTGTCGCCTGCCCACGACAA No data
Right 1040287795 8:46109356-46109378 GATCCATCCGCGACGGACACAGG No data
1040287787_1040287795 11 Left 1040287787 8:46109322-46109344 CCCACGACAACCTGTGGCCTTGT No data
Right 1040287795 8:46109356-46109378 GATCCATCCGCGACGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040287795 Original CRISPR GATCCATCCGCGACGGACAC AGG Intergenic