ID: 1040287798

View in Genome Browser
Species Human (GRCh38)
Location 8:46109376-46109398
Sequence AGGCACCATGCTCCAGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040287788_1040287798 30 Left 1040287788 8:46109323-46109345 CCACGACAACCTGTGGCCTTGTT No data
Right 1040287798 8:46109376-46109398 AGGCACCATGCTCCAGAACCTGG No data
1040287793_1040287798 14 Left 1040287793 8:46109339-46109361 CCTTGTTTTCACTTGGGGATCCA No data
Right 1040287798 8:46109376-46109398 AGGCACCATGCTCCAGAACCTGG No data
1040287789_1040287798 21 Left 1040287789 8:46109332-46109354 CCTGTGGCCTTGTTTTCACTTGG No data
Right 1040287798 8:46109376-46109398 AGGCACCATGCTCCAGAACCTGG No data
1040287796_1040287798 -6 Left 1040287796 8:46109359-46109381 CCATCCGCGACGGACACAGGCAC No data
Right 1040287798 8:46109376-46109398 AGGCACCATGCTCCAGAACCTGG No data
1040287797_1040287798 -10 Left 1040287797 8:46109363-46109385 CCGCGACGGACACAGGCACCATG No data
Right 1040287798 8:46109376-46109398 AGGCACCATGCTCCAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040287798 Original CRISPR AGGCACCATGCTCCAGAACC TGG Intergenic