ID: 1040289754

View in Genome Browser
Species Human (GRCh38)
Location 8:46118219-46118241
Sequence GCCCACCTGAAACAGCCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040289751_1040289754 -3 Left 1040289751 8:46118199-46118221 CCAAAGCCTATGGCTTTACAGCC No data
Right 1040289754 8:46118219-46118241 GCCCACCTGAAACAGCCCTAGGG No data
1040289750_1040289754 2 Left 1040289750 8:46118194-46118216 CCGCTCCAAAGCCTATGGCTTTA No data
Right 1040289754 8:46118219-46118241 GCCCACCTGAAACAGCCCTAGGG No data
1040289752_1040289754 -9 Left 1040289752 8:46118205-46118227 CCTATGGCTTTACAGCCCACCTG No data
Right 1040289754 8:46118219-46118241 GCCCACCTGAAACAGCCCTAGGG No data
1040289748_1040289754 26 Left 1040289748 8:46118170-46118192 CCTTCGGTGAGAGACACAGACAC No data
Right 1040289754 8:46118219-46118241 GCCCACCTGAAACAGCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040289754 Original CRISPR GCCCACCTGAAACAGCCCTA GGG Intergenic