ID: 1040291661

View in Genome Browser
Species Human (GRCh38)
Location 8:46128656-46128678
Sequence GCAAAATCTGGGCCACAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291661_1040291668 6 Left 1040291661 8:46128656-46128678 CCACCCTGTGGCCCAGATTTTGC No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291661_1040291671 26 Left 1040291661 8:46128656-46128678 CCACCCTGTGGCCCAGATTTTGC No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data
1040291661_1040291672 29 Left 1040291661 8:46128656-46128678 CCACCCTGTGGCCCAGATTTTGC No data
Right 1040291672 8:46128708-46128730 CACCCTGTTCCAAAGCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291661 Original CRISPR GCAAAATCTGGGCCACAGGG TGG (reversed) Intergenic