ID: 1040291666

View in Genome Browser
Species Human (GRCh38)
Location 8:46128667-46128689
Sequence GGCCTCCACAAGCAAAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291666_1040291668 -5 Left 1040291666 8:46128667-46128689 CCCAGATTTTGCTTGTGGAGGCC No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291666_1040291672 18 Left 1040291666 8:46128667-46128689 CCCAGATTTTGCTTGTGGAGGCC No data
Right 1040291672 8:46128708-46128730 CACCCTGTTCCAAAGCCTGGTGG No data
1040291666_1040291671 15 Left 1040291666 8:46128667-46128689 CCCAGATTTTGCTTGTGGAGGCC No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291666 Original CRISPR GGCCTCCACAAGCAAAATCT GGG (reversed) Intergenic