ID: 1040291668

View in Genome Browser
Species Human (GRCh38)
Location 8:46128685-46128707
Sequence AGGCCTTCCTCTAGAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291667_1040291668 -6 Left 1040291667 8:46128668-46128690 CCAGATTTTGCTTGTGGAGGCCT No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291656_1040291668 23 Left 1040291656 8:46128639-46128661 CCTGTGTCCGGCCCATGCCACCC No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291666_1040291668 -5 Left 1040291666 8:46128667-46128689 CCCAGATTTTGCTTGTGGAGGCC No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291660_1040291668 11 Left 1040291660 8:46128651-46128673 CCATGCCACCCTGTGGCCCAGAT No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291658_1040291668 16 Left 1040291658 8:46128646-46128668 CCGGCCCATGCCACCCTGTGGCC No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291662_1040291668 3 Left 1040291662 8:46128659-46128681 CCCTGTGGCCCAGATTTTGCTTG No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291659_1040291668 12 Left 1040291659 8:46128650-46128672 CCCATGCCACCCTGTGGCCCAGA No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291663_1040291668 2 Left 1040291663 8:46128660-46128682 CCTGTGGCCCAGATTTTGCTTGT No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data
1040291661_1040291668 6 Left 1040291661 8:46128656-46128678 CCACCCTGTGGCCCAGATTTTGC No data
Right 1040291668 8:46128685-46128707 AGGCCTTCCTCTAGAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291668 Original CRISPR AGGCCTTCCTCTAGAGACAC AGG Intergenic