ID: 1040291669

View in Genome Browser
Species Human (GRCh38)
Location 8:46128688-46128710
Sequence GTGCCTGTGTCTCTAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291669_1040291680 25 Left 1040291669 8:46128688-46128710 CCTTCCTCTAGAGACACAGGCAC No data
Right 1040291680 8:46128736-46128758 AGCCCGCCTGGGACAATCCTGGG No data
1040291669_1040291678 14 Left 1040291669 8:46128688-46128710 CCTTCCTCTAGAGACACAGGCAC No data
Right 1040291678 8:46128725-46128747 TGGTGGTTTACAGCCCGCCTGGG No data
1040291669_1040291672 -3 Left 1040291669 8:46128688-46128710 CCTTCCTCTAGAGACACAGGCAC No data
Right 1040291672 8:46128708-46128730 CACCCTGTTCCAAAGCCTGGTGG No data
1040291669_1040291677 13 Left 1040291669 8:46128688-46128710 CCTTCCTCTAGAGACACAGGCAC No data
Right 1040291677 8:46128724-46128746 CTGGTGGTTTACAGCCCGCCTGG No data
1040291669_1040291679 24 Left 1040291669 8:46128688-46128710 CCTTCCTCTAGAGACACAGGCAC No data
Right 1040291679 8:46128735-46128757 CAGCCCGCCTGGGACAATCCTGG No data
1040291669_1040291671 -6 Left 1040291669 8:46128688-46128710 CCTTCCTCTAGAGACACAGGCAC No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291669 Original CRISPR GTGCCTGTGTCTCTAGAGGA AGG (reversed) Intergenic