ID: 1040291671

View in Genome Browser
Species Human (GRCh38)
Location 8:46128705-46128727
Sequence AGGCACCCTGTTCCAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291669_1040291671 -6 Left 1040291669 8:46128688-46128710 CCTTCCTCTAGAGACACAGGCAC No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data
1040291667_1040291671 14 Left 1040291667 8:46128668-46128690 CCAGATTTTGCTTGTGGAGGCCT No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data
1040291662_1040291671 23 Left 1040291662 8:46128659-46128681 CCCTGTGGCCCAGATTTTGCTTG No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data
1040291670_1040291671 -10 Left 1040291670 8:46128692-46128714 CCTCTAGAGACACAGGCACCCTG No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data
1040291666_1040291671 15 Left 1040291666 8:46128667-46128689 CCCAGATTTTGCTTGTGGAGGCC No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data
1040291663_1040291671 22 Left 1040291663 8:46128660-46128682 CCTGTGGCCCAGATTTTGCTTGT No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data
1040291661_1040291671 26 Left 1040291661 8:46128656-46128678 CCACCCTGTGGCCCAGATTTTGC No data
Right 1040291671 8:46128705-46128727 AGGCACCCTGTTCCAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291671 Original CRISPR AGGCACCCTGTTCCAAAGCC TGG Intergenic