ID: 1040291674

View in Genome Browser
Species Human (GRCh38)
Location 8:46128711-46128733
Sequence AAACCACCAGGCTTTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291674_1040291677 -10 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291677 8:46128724-46128746 CTGGTGGTTTACAGCCCGCCTGG No data
1040291674_1040291687 22 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291687 8:46128756-46128778 GGGTGCTTCTGGGATCAGAGAGG No data
1040291674_1040291684 11 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291684 8:46128745-46128767 GGGACAATCCTGGGTGCTTCTGG No data
1040291674_1040291685 12 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291685 8:46128746-46128768 GGACAATCCTGGGTGCTTCTGGG No data
1040291674_1040291678 -9 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291678 8:46128725-46128747 TGGTGGTTTACAGCCCGCCTGGG No data
1040291674_1040291680 2 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291680 8:46128736-46128758 AGCCCGCCTGGGACAATCCTGGG No data
1040291674_1040291679 1 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291679 8:46128735-46128757 CAGCCCGCCTGGGACAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291674 Original CRISPR AAACCACCAGGCTTTGGAAC AGG (reversed) Intergenic