ID: 1040291675

View in Genome Browser
Species Human (GRCh38)
Location 8:46128717-46128739
Sequence GGCTGTAAACCACCAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291675_1040291687 16 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291687 8:46128756-46128778 GGGTGCTTCTGGGATCAGAGAGG No data
1040291675_1040291680 -4 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291680 8:46128736-46128758 AGCCCGCCTGGGACAATCCTGGG No data
1040291675_1040291689 26 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291689 8:46128766-46128788 GGGATCAGAGAGGTCTCATTGGG No data
1040291675_1040291685 6 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291685 8:46128746-46128768 GGACAATCCTGGGTGCTTCTGGG No data
1040291675_1040291684 5 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291684 8:46128745-46128767 GGGACAATCCTGGGTGCTTCTGG No data
1040291675_1040291688 25 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291688 8:46128765-46128787 TGGGATCAGAGAGGTCTCATTGG No data
1040291675_1040291679 -5 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291679 8:46128735-46128757 CAGCCCGCCTGGGACAATCCTGG No data
1040291675_1040291690 29 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291690 8:46128769-46128791 ATCAGAGAGGTCTCATTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291675 Original CRISPR GGCTGTAAACCACCAGGCTT TGG (reversed) Intergenic