ID: 1040291677

View in Genome Browser
Species Human (GRCh38)
Location 8:46128724-46128746
Sequence CTGGTGGTTTACAGCCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291670_1040291677 9 Left 1040291670 8:46128692-46128714 CCTCTAGAGACACAGGCACCCTG No data
Right 1040291677 8:46128724-46128746 CTGGTGGTTTACAGCCCGCCTGG No data
1040291669_1040291677 13 Left 1040291669 8:46128688-46128710 CCTTCCTCTAGAGACACAGGCAC No data
Right 1040291677 8:46128724-46128746 CTGGTGGTTTACAGCCCGCCTGG No data
1040291674_1040291677 -10 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291677 8:46128724-46128746 CTGGTGGTTTACAGCCCGCCTGG No data
1040291673_1040291677 -9 Left 1040291673 8:46128710-46128732 CCCTGTTCCAAAGCCTGGTGGTT No data
Right 1040291677 8:46128724-46128746 CTGGTGGTTTACAGCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291677 Original CRISPR CTGGTGGTTTACAGCCCGCC TGG Intergenic