ID: 1040291684

View in Genome Browser
Species Human (GRCh38)
Location 8:46128745-46128767
Sequence GGGACAATCCTGGGTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291674_1040291684 11 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291684 8:46128745-46128767 GGGACAATCCTGGGTGCTTCTGG No data
1040291673_1040291684 12 Left 1040291673 8:46128710-46128732 CCCTGTTCCAAAGCCTGGTGGTT No data
Right 1040291684 8:46128745-46128767 GGGACAATCCTGGGTGCTTCTGG No data
1040291670_1040291684 30 Left 1040291670 8:46128692-46128714 CCTCTAGAGACACAGGCACCCTG No data
Right 1040291684 8:46128745-46128767 GGGACAATCCTGGGTGCTTCTGG No data
1040291675_1040291684 5 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291684 8:46128745-46128767 GGGACAATCCTGGGTGCTTCTGG No data
1040291676_1040291684 -1 Left 1040291676 8:46128723-46128745 CCTGGTGGTTTACAGCCCGCCTG No data
Right 1040291684 8:46128745-46128767 GGGACAATCCTGGGTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291684 Original CRISPR GGGACAATCCTGGGTGCTTC TGG Intergenic