ID: 1040291685

View in Genome Browser
Species Human (GRCh38)
Location 8:46128746-46128768
Sequence GGACAATCCTGGGTGCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291674_1040291685 12 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291685 8:46128746-46128768 GGACAATCCTGGGTGCTTCTGGG No data
1040291673_1040291685 13 Left 1040291673 8:46128710-46128732 CCCTGTTCCAAAGCCTGGTGGTT No data
Right 1040291685 8:46128746-46128768 GGACAATCCTGGGTGCTTCTGGG No data
1040291676_1040291685 0 Left 1040291676 8:46128723-46128745 CCTGGTGGTTTACAGCCCGCCTG No data
Right 1040291685 8:46128746-46128768 GGACAATCCTGGGTGCTTCTGGG No data
1040291675_1040291685 6 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291685 8:46128746-46128768 GGACAATCCTGGGTGCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291685 Original CRISPR GGACAATCCTGGGTGCTTCT GGG Intergenic