ID: 1040291687

View in Genome Browser
Species Human (GRCh38)
Location 8:46128756-46128778
Sequence GGGTGCTTCTGGGATCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040291682_1040291687 -6 Left 1040291682 8:46128739-46128761 CCGCCTGGGACAATCCTGGGTGC No data
Right 1040291687 8:46128756-46128778 GGGTGCTTCTGGGATCAGAGAGG No data
1040291681_1040291687 -5 Left 1040291681 8:46128738-46128760 CCCGCCTGGGACAATCCTGGGTG No data
Right 1040291687 8:46128756-46128778 GGGTGCTTCTGGGATCAGAGAGG No data
1040291683_1040291687 -9 Left 1040291683 8:46128742-46128764 CCTGGGACAATCCTGGGTGCTTC No data
Right 1040291687 8:46128756-46128778 GGGTGCTTCTGGGATCAGAGAGG No data
1040291673_1040291687 23 Left 1040291673 8:46128710-46128732 CCCTGTTCCAAAGCCTGGTGGTT No data
Right 1040291687 8:46128756-46128778 GGGTGCTTCTGGGATCAGAGAGG No data
1040291676_1040291687 10 Left 1040291676 8:46128723-46128745 CCTGGTGGTTTACAGCCCGCCTG No data
Right 1040291687 8:46128756-46128778 GGGTGCTTCTGGGATCAGAGAGG No data
1040291674_1040291687 22 Left 1040291674 8:46128711-46128733 CCTGTTCCAAAGCCTGGTGGTTT No data
Right 1040291687 8:46128756-46128778 GGGTGCTTCTGGGATCAGAGAGG No data
1040291675_1040291687 16 Left 1040291675 8:46128717-46128739 CCAAAGCCTGGTGGTTTACAGCC No data
Right 1040291687 8:46128756-46128778 GGGTGCTTCTGGGATCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040291687 Original CRISPR GGGTGCTTCTGGGATCAGAG AGG Intergenic