ID: 1040293921

View in Genome Browser
Species Human (GRCh38)
Location 8:46139502-46139524
Sequence GCGAAAACAGTGCTGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040293921_1040293930 28 Left 1040293921 8:46139502-46139524 CCACCCTGCAGCACTGTTTTCGC No data
Right 1040293930 8:46139553-46139575 GCACCCTGCTTCAAATCCTGGGG No data
1040293921_1040293928 26 Left 1040293921 8:46139502-46139524 CCACCCTGCAGCACTGTTTTCGC No data
Right 1040293928 8:46139551-46139573 AGGCACCCTGCTTCAAATCCTGG No data
1040293921_1040293929 27 Left 1040293921 8:46139502-46139524 CCACCCTGCAGCACTGTTTTCGC No data
Right 1040293929 8:46139552-46139574 GGCACCCTGCTTCAAATCCTGGG No data
1040293921_1040293926 6 Left 1040293921 8:46139502-46139524 CCACCCTGCAGCACTGTTTTCGC No data
Right 1040293926 8:46139531-46139553 GGGCCTTTTGCGAGAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040293921 Original CRISPR GCGAAAACAGTGCTGCAGGG TGG (reversed) Intergenic