ID: 1040296233

View in Genome Browser
Species Human (GRCh38)
Location 8:46150541-46150563
Sequence CCGCCCTACTTTAAAACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040296229_1040296233 -4 Left 1040296229 8:46150522-46150544 CCTTTTGCAAGAGACACATCCGC No data
Right 1040296233 8:46150541-46150563 CCGCCCTACTTTAAAACCTGGGG No data
1040296225_1040296233 25 Left 1040296225 8:46150493-46150515 CCCTATTGTCCTGAGTTTGCTTG No data
Right 1040296233 8:46150541-46150563 CCGCCCTACTTTAAAACCTGGGG No data
1040296228_1040296233 16 Left 1040296228 8:46150502-46150524 CCTGAGTTTGCTTGTAGTGGCCT No data
Right 1040296233 8:46150541-46150563 CCGCCCTACTTTAAAACCTGGGG No data
1040296226_1040296233 24 Left 1040296226 8:46150494-46150516 CCTATTGTCCTGAGTTTGCTTGT No data
Right 1040296233 8:46150541-46150563 CCGCCCTACTTTAAAACCTGGGG No data
1040296224_1040296233 28 Left 1040296224 8:46150490-46150512 CCGCCCTATTGTCCTGAGTTTGC No data
Right 1040296233 8:46150541-46150563 CCGCCCTACTTTAAAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040296233 Original CRISPR CCGCCCTACTTTAAAACCTG GGG Intergenic
No off target data available for this crispr