ID: 1040299674

View in Genome Browser
Species Human (GRCh38)
Location 8:46181372-46181394
Sequence AAGCCCCACGCTTTGGAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040299674_1040299679 2 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299679 8:46181397-46181419 CAGCCTGCTTGGGACAGTCCGGG No data
1040299674_1040299688 23 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299688 8:46181418-46181440 GGAGGGTTCTGGGATGGGAAAGG No data
1040299674_1040299683 12 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299683 8:46181407-46181429 GGGACAGTCCGGGAGGGTTCTGG No data
1040299674_1040299684 13 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299684 8:46181408-46181430 GGACAGTCCGGGAGGGTTCTGGG No data
1040299674_1040299682 6 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299682 8:46181401-46181423 CTGCTTGGGACAGTCCGGGAGGG No data
1040299674_1040299681 5 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299681 8:46181400-46181422 CCTGCTTGGGACAGTCCGGGAGG No data
1040299674_1040299678 1 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299678 8:46181396-46181418 ACAGCCTGCTTGGGACAGTCCGG No data
1040299674_1040299685 17 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299685 8:46181412-46181434 AGTCCGGGAGGGTTCTGGGATGG No data
1040299674_1040299676 -9 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299676 8:46181386-46181408 GTGGGGCTTTACAGCCTGCTTGG No data
1040299674_1040299677 -8 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299677 8:46181387-46181409 TGGGGCTTTACAGCCTGCTTGGG No data
1040299674_1040299686 18 Left 1040299674 8:46181372-46181394 CCGGTCTCCAAAGCGTGGGGCTT No data
Right 1040299686 8:46181413-46181435 GTCCGGGAGGGTTCTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040299674 Original CRISPR AAGCCCCACGCTTTGGAGAC CGG (reversed) Intergenic
No off target data available for this crispr