ID: 1040299713

View in Genome Browser
Species Human (GRCh38)
Location 8:46181535-46181557
Sequence GCAAAAACAAGGCCACAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040299713_1040299719 13 Left 1040299713 8:46181535-46181557 CCACACTGTGGCCTTGTTTTTGC No data
Right 1040299719 8:46181571-46181593 CCGCTAAAGACACAGGTACCCGG No data
1040299713_1040299717 6 Left 1040299713 8:46181535-46181557 CCACACTGTGGCCTTGTTTTTGC No data
Right 1040299717 8:46181564-46181586 GAGTCTTCCGCTAAAGACACAGG No data
1040299713_1040299720 28 Left 1040299713 8:46181535-46181557 CCACACTGTGGCCTTGTTTTTGC No data
Right 1040299720 8:46181586-46181608 GTACCCGGCTTCAAAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040299713 Original CRISPR GCAAAAACAAGGCCACAGTG TGG (reversed) Intergenic
No off target data available for this crispr