ID: 1040299878

View in Genome Browser
Species Human (GRCh38)
Location 8:46182429-46182451
Sequence GTGCCAGTGTCTCTCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040299878_1040299888 24 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299888 8:46182476-46182498 CAGCCTGTCTGGGACAGACCTGG No data
1040299878_1040299879 -6 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299879 8:46182446-46182468 TGGCACCCACCTCCAAATTCTGG No data
1040299878_1040299886 13 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299886 8:46182465-46182487 CTGGGGAACTACAGCCTGTCTGG No data
1040299878_1040299880 -5 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299880 8:46182447-46182469 GGCACCCACCTCCAAATTCTGGG No data
1040299878_1040299890 26 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299890 8:46182478-46182500 GCCTGTCTGGGACAGACCTGGGG No data
1040299878_1040299881 -4 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299881 8:46182448-46182470 GCACCCACCTCCAAATTCTGGGG No data
1040299878_1040299889 25 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299889 8:46182477-46182499 AGCCTGTCTGGGACAGACCTGGG No data
1040299878_1040299887 14 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299887 8:46182466-46182488 TGGGGAACTACAGCCTGTCTGGG No data
1040299878_1040299892 27 Left 1040299878 8:46182429-46182451 CCATCTGTGAGAGACACTGGCAC No data
Right 1040299892 8:46182479-46182501 CCTGTCTGGGACAGACCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040299878 Original CRISPR GTGCCAGTGTCTCTCACAGA TGG (reversed) Intergenic
No off target data available for this crispr