ID: 1040299882

View in Genome Browser
Species Human (GRCh38)
Location 8:46182451-46182473
Sequence GTTCCCCAGAATTTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040299882_1040299888 2 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299888 8:46182476-46182498 CAGCCTGTCTGGGACAGACCTGG No data
1040299882_1040299895 18 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299895 8:46182492-46182514 GACCTGGGGGCTTCTGGGATAGG No data
1040299882_1040299892 5 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299892 8:46182479-46182501 CCTGTCTGGGACAGACCTGGGGG No data
1040299882_1040299890 4 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299890 8:46182478-46182500 GCCTGTCTGGGACAGACCTGGGG No data
1040299882_1040299893 12 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299893 8:46182486-46182508 GGGACAGACCTGGGGGCTTCTGG No data
1040299882_1040299889 3 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299889 8:46182477-46182499 AGCCTGTCTGGGACAGACCTGGG No data
1040299882_1040299897 23 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299897 8:46182497-46182519 GGGGGCTTCTGGGATAGGAGAGG No data
1040299882_1040299887 -8 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299887 8:46182466-46182488 TGGGGAACTACAGCCTGTCTGGG No data
1040299882_1040299894 13 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299894 8:46182487-46182509 GGACAGACCTGGGGGCTTCTGGG No data
1040299882_1040299886 -9 Left 1040299882 8:46182451-46182473 CCCACCTCCAAATTCTGGGGAAC No data
Right 1040299886 8:46182465-46182487 CTGGGGAACTACAGCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040299882 Original CRISPR GTTCCCCAGAATTTGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr